Incidental Mutation 'R4868:Pmpcb'
ID376310
Institutional Source Beutler Lab
Gene Symbol Pmpcb
Ensembl Gene ENSMUSG00000029017
Gene Namepeptidase (mitochondrial processing) beta
SynonymsMPPP52, MPP11, 3110004O18Rik
MMRRC Submission 042478-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4868 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21737141-21757152 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 21748853 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 366 (Y366*)
Ref Sequence ENSEMBL: ENSMUSP00000030882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030882]
Predicted Effect probably null
Transcript: ENSMUST00000030882
AA Change: Y366*
SMART Domains Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017
AA Change: Y366*

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Peptidase_M16 68 215 6.1e-59 PFAM
Pfam:Peptidase_M16_C 220 404 4.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125693
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This protein is located in the mitochondrial matrix and catalyzes the cleavage of the leader peptides of precursor proteins newly imported into the mitochondria, though it only functions as part of a heterodimeric complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruptin exhibit embryonic lethality at E8. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,710,097 *299W probably null Het
4933412E24Rik G A 15: 60,015,968 L208F possibly damaging Het
Abca8b G A 11: 109,974,512 A373V probably benign Het
Actn3 A T 19: 4,864,454 W549R probably benign Het
Adamts4 C T 1: 171,252,431 probably benign Het
Adcy4 T C 14: 55,773,722 I615V probably benign Het
Akap1 A G 11: 88,844,553 S428P possibly damaging Het
Akap13 A T 7: 75,743,504 R2476W probably damaging Het
Alx3 A G 3: 107,600,627 S151G possibly damaging Het
Aoah T A 13: 20,914,981 Y243* probably null Het
Asap1 A G 15: 64,094,181 V1025A probably benign Het
Atp8b1 A T 18: 64,551,866 I728N probably damaging Het
Baz2b C A 2: 59,924,882 V1001L possibly damaging Het
Bmpr2 T A 1: 59,870,456 S1030T probably benign Het
Cacna2d3 A T 14: 28,956,786 probably null Het
Casp3 A T 8: 46,634,279 N87I probably benign Het
Ccdc171 T A 4: 83,694,332 L995Q probably damaging Het
Ccdc80 T A 16: 45,104,413 Y637N probably damaging Het
Ccr4 A G 9: 114,492,833 F55L probably benign Het
Cmah T A 13: 24,464,264 V494E probably damaging Het
Cnot6l A G 5: 96,083,023 Y362H probably damaging Het
Coq6 T C 12: 84,370,952 V222A probably damaging Het
Ctdspl2 C A 2: 121,993,398 T240N possibly damaging Het
D430041D05Rik T C 2: 104,255,409 T248A possibly damaging Het
Dctn6 A T 8: 34,092,076 probably benign Het
Dhx34 T C 7: 16,199,802 D955G probably benign Het
Dnaaf5 A G 5: 139,170,186 M541V probably benign Het
Dnah17 A T 11: 118,108,212 S912T probably benign Het
Dnah2 A T 11: 69,463,648 V2248E probably damaging Het
Dysf T C 6: 84,179,693 W1502R probably damaging Het
Dzip1 A T 14: 118,877,214 V843E probably damaging Het
Esp23 G T 17: 39,074,024 T27K probably benign Het
Esp3 A T 17: 40,633,529 M21L possibly damaging Het
Fam43b T A 4: 138,395,797 T71S probably benign Het
Fam46b A G 4: 133,486,082 probably null Het
Fpgs G A 2: 32,692,661 R63C probably damaging Het
H2-M11 G T 17: 36,548,919 W268L probably damaging Het
Inpp5b T C 4: 124,751,410 S210P probably damaging Het
Itsn1 T A 16: 91,785,317 S51T probably damaging Het
Kctd2 G A 11: 115,429,379 V246I probably damaging Het
Krt75 C T 15: 101,568,121 G403E probably damaging Het
Lamp3 T A 16: 19,701,290 T48S probably benign Het
Lyzl4 C A 9: 121,583,009 V114L probably damaging Het
Maml3 C A 3: 52,103,924 E74* probably null Het
Map2k7 G A 8: 4,247,751 probably benign Het
Mapk8ip3 A G 17: 24,901,415 V883A probably benign Het
Mbtps1 C T 8: 119,508,928 V1004I probably benign Het
Metap1 G T 3: 138,483,089 H48Q probably damaging Het
Mical2 T A 7: 112,318,624 V396E probably damaging Het
Mks1 T A 11: 87,853,723 probably benign Het
Ndst1 T C 18: 60,695,476 T669A probably benign Het
Obox3 T C 7: 15,627,310 K10R probably damaging Het
Olfr1014 T G 2: 85,776,626 V14G possibly damaging Het
Olfr1318 T A 2: 112,156,571 S207T probably damaging Het
Olfr711 C T 7: 106,971,767 M192I probably benign Het
Opn3 T C 1: 175,663,561 Y302C probably damaging Het
Pdzph1 A T 17: 58,974,756 V177D probably benign Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Prr14l A T 5: 32,829,937 M738K probably benign Het
Prx T C 7: 27,517,579 S641P probably benign Het
Ptchd3 A G 11: 121,831,057 Y252C possibly damaging Het
Reg3a A G 6: 78,381,900 E27G probably damaging Het
Ripor2 A G 13: 24,694,141 T300A possibly damaging Het
Sdf4 T A 4: 156,009,185 S259T probably damaging Het
Sike1 A G 3: 102,997,414 probably null Het
Sis T G 3: 72,943,548 I606L probably benign Het
Slc30a9 T C 5: 67,324,683 I94T probably benign Het
Slc5a4a T C 10: 76,178,231 I424T probably damaging Het
Spx C T 6: 142,416,390 R72* probably null Het
St7 C A 6: 17,819,266 N56K probably damaging Het
Tcte2 C A 17: 13,728,008 G3V probably damaging Het
Tgfb3 T C 12: 86,062,181 D258G probably benign Het
Timeless G T 10: 128,247,361 G659V probably benign Het
Tnn T C 1: 160,130,873 R467G possibly damaging Het
Tor1b T C 2: 30,956,577 probably null Het
Trank1 T A 9: 111,365,641 L911Q probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ttyh3 A T 5: 140,629,466 I389N probably damaging Het
Ube3b T C 5: 114,398,427 V216A probably benign Het
Vezf1 T A 11: 88,074,694 V254E probably damaging Het
Vmn1r122 T C 7: 21,133,302 E276G probably benign Het
Vmn1r167 T A 7: 23,504,736 N285I probably benign Het
Vmn2r45 T A 7: 8,481,481 I442F probably benign Het
Vwa8 C A 14: 79,183,082 A1741E probably damaging Het
Wdr20 T A 12: 110,738,234 V69E probably damaging Het
Xkr4 T G 1: 3,216,851 Q372P probably damaging Het
Zcchc11 T C 4: 108,549,220 probably benign Het
Other mutations in Pmpcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Pmpcb APN 5 21740478 splice site probably benign
IGL02123:Pmpcb APN 5 21743375 unclassified probably benign
IGL03271:Pmpcb APN 5 21738876 missense probably benign
PIT4504001:Pmpcb UTSW 5 21743390 missense probably damaging 0.97
PIT4651001:Pmpcb UTSW 5 21746050 missense probably benign 0.00
R0104:Pmpcb UTSW 5 21746038 nonsense probably null
R0157:Pmpcb UTSW 5 21742952 missense probably damaging 1.00
R0374:Pmpcb UTSW 5 21748831 missense probably damaging 1.00
R0842:Pmpcb UTSW 5 21748774 missense possibly damaging 0.95
R4888:Pmpcb UTSW 5 21740662 intron probably benign
R4970:Pmpcb UTSW 5 21756443 missense probably damaging 1.00
R5112:Pmpcb UTSW 5 21756443 missense probably damaging 1.00
R5618:Pmpcb UTSW 5 21742788 missense possibly damaging 0.73
R5658:Pmpcb UTSW 5 21739001 missense probably damaging 0.99
R5875:Pmpcb UTSW 5 21742946 missense probably benign 0.04
R6150:Pmpcb UTSW 5 21737139 unclassified probably null
R6175:Pmpcb UTSW 5 21757033 missense probably benign
R7201:Pmpcb UTSW 5 21737179 start codon destroyed probably null 0.02
R7450:Pmpcb UTSW 5 21746985 missense possibly damaging 0.46
R7764:Pmpcb UTSW 5 21743452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTAAGAGTTACAGAGCTCAC -3'
(R):5'- GACCTGTAAAGGGGATAACATTTG -3'

Sequencing Primer
(F):5'- TGCCCAGTTCACAAATCC -3'
(R):5'- ACCACCATTAGGAAAATGG -3'
Posted On2016-03-17