Incidental Mutation 'R4868:Ube3b'
ID 376314
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 042478-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4868 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114536488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 216 (V216A)
Ref Sequence ENSEMBL: ENSMUSP00000138723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably benign
Transcript: ENSMUST00000074002
AA Change: F245L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: F245L

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
AA Change: V216A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577
AA Change: V216A

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150630
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 106,436,729 (GRCm39) *299W probably null Het
4933412E24Rik G A 15: 59,887,817 (GRCm39) L208F possibly damaging Het
Abca8b G A 11: 109,865,338 (GRCm39) A373V probably benign Het
Actn3 A T 19: 4,914,482 (GRCm39) W549R probably benign Het
Adamts4 C T 1: 171,080,000 (GRCm39) probably benign Het
Adcy4 T C 14: 56,011,179 (GRCm39) I615V probably benign Het
Akap1 A G 11: 88,735,379 (GRCm39) S428P possibly damaging Het
Akap13 A T 7: 75,393,252 (GRCm39) R2476W probably damaging Het
Alx3 A G 3: 107,507,943 (GRCm39) S151G possibly damaging Het
Aoah T A 13: 21,099,151 (GRCm39) Y243* probably null Het
Asap1 A G 15: 63,966,030 (GRCm39) V1025A probably benign Het
Atp8b1 A T 18: 64,684,937 (GRCm39) I728N probably damaging Het
Baz2b C A 2: 59,755,226 (GRCm39) V1001L possibly damaging Het
Bmpr2 T A 1: 59,909,615 (GRCm39) S1030T probably benign Het
Cacna2d3 A T 14: 28,678,743 (GRCm39) probably null Het
Casp3 A T 8: 47,087,314 (GRCm39) N87I probably benign Het
Ccdc171 T A 4: 83,612,569 (GRCm39) L995Q probably damaging Het
Ccdc80 T A 16: 44,924,776 (GRCm39) Y637N probably damaging Het
Ccr4 A G 9: 114,321,901 (GRCm39) F55L probably benign Het
Cmah T A 13: 24,648,247 (GRCm39) V494E probably damaging Het
Cnot6l A G 5: 96,230,882 (GRCm39) Y362H probably damaging Het
Coq6 T C 12: 84,417,726 (GRCm39) V222A probably damaging Het
Ctdspl2 C A 2: 121,823,879 (GRCm39) T240N possibly damaging Het
D430041D05Rik T C 2: 104,085,754 (GRCm39) T248A possibly damaging Het
Dctn6 A T 8: 34,559,230 (GRCm39) probably benign Het
Dhx34 T C 7: 15,933,727 (GRCm39) D955G probably benign Het
Dnaaf5 A G 5: 139,155,941 (GRCm39) M541V probably benign Het
Dnah17 A T 11: 117,999,038 (GRCm39) S912T probably benign Het
Dnah2 A T 11: 69,354,474 (GRCm39) V2248E probably damaging Het
Dysf T C 6: 84,156,675 (GRCm39) W1502R probably damaging Het
Dzip1 A T 14: 119,114,626 (GRCm39) V843E probably damaging Het
Esp23 G T 17: 39,384,915 (GRCm39) T27K probably benign Het
Esp3 A T 17: 40,944,420 (GRCm39) M21L possibly damaging Het
Fam43b T A 4: 138,123,108 (GRCm39) T71S probably benign Het
Fpgs G A 2: 32,582,673 (GRCm39) R63C probably damaging Het
H2-M11 G T 17: 36,859,811 (GRCm39) W268L probably damaging Het
Inpp5b T C 4: 124,645,203 (GRCm39) S210P probably damaging Het
Itsn1 T A 16: 91,582,205 (GRCm39) S51T probably damaging Het
Kctd2 G A 11: 115,320,205 (GRCm39) V246I probably damaging Het
Krt75 C T 15: 101,476,556 (GRCm39) G403E probably damaging Het
Lamp3 T A 16: 19,520,040 (GRCm39) T48S probably benign Het
Lyzl4 C A 9: 121,412,075 (GRCm39) V114L probably damaging Het
Maml3 C A 3: 52,011,345 (GRCm39) E74* probably null Het
Map2k7 G A 8: 4,297,751 (GRCm39) probably benign Het
Mapk8ip3 A G 17: 25,120,389 (GRCm39) V883A probably benign Het
Mbtps1 C T 8: 120,235,667 (GRCm39) V1004I probably benign Het
Metap1 G T 3: 138,188,850 (GRCm39) H48Q probably damaging Het
Mical2 T A 7: 111,917,831 (GRCm39) V396E probably damaging Het
Mks1 T A 11: 87,744,549 (GRCm39) probably benign Het
Ndst1 T C 18: 60,828,548 (GRCm39) T669A probably benign Het
Obox3 T C 7: 15,361,235 (GRCm39) K10R probably damaging Het
Opn3 T C 1: 175,491,127 (GRCm39) Y302C probably damaging Het
Or4f62 T A 2: 111,986,916 (GRCm39) S207T probably damaging Het
Or6b6 C T 7: 106,570,974 (GRCm39) M192I probably benign Het
Or9g8 T G 2: 85,606,970 (GRCm39) V14G possibly damaging Het
Pdzph1 A T 17: 59,281,751 (GRCm39) V177D probably benign Het
Pex5l T A 3: 33,006,639 (GRCm39) I577F probably damaging Het
Pmpcb T A 5: 21,953,851 (GRCm39) Y366* probably null Het
Prr14l A T 5: 32,987,281 (GRCm39) M738K probably benign Het
Prx T C 7: 27,217,004 (GRCm39) S641P probably benign Het
Ptchd3 A G 11: 121,721,883 (GRCm39) Y252C possibly damaging Het
Reg3a A G 6: 78,358,883 (GRCm39) E27G probably damaging Het
Ripor2 A G 13: 24,878,124 (GRCm39) T300A possibly damaging Het
Sdf4 T A 4: 156,093,642 (GRCm39) S259T probably damaging Het
Sike1 A G 3: 102,904,730 (GRCm39) probably null Het
Sis T G 3: 72,850,881 (GRCm39) I606L probably benign Het
Slc30a9 T C 5: 67,482,026 (GRCm39) I94T probably benign Het
Slc5a4a T C 10: 76,014,065 (GRCm39) I424T probably damaging Het
Spx C T 6: 142,362,116 (GRCm39) R72* probably null Het
St7 C A 6: 17,819,265 (GRCm39) N56K probably damaging Het
Tcte2 C A 17: 13,948,270 (GRCm39) G3V probably damaging Het
Tent5b A G 4: 133,213,393 (GRCm39) probably null Het
Tgfb3 T C 12: 86,108,955 (GRCm39) D258G probably benign Het
Timeless G T 10: 128,083,230 (GRCm39) G659V probably benign Het
Tnn T C 1: 159,958,443 (GRCm39) R467G possibly damaging Het
Tor1b T C 2: 30,846,589 (GRCm39) probably null Het
Trank1 T A 9: 111,194,709 (GRCm39) L911Q probably damaging Het
Ttll2 C T 17: 7,618,998 (GRCm39) V310I probably benign Het
Ttyh3 A T 5: 140,615,221 (GRCm39) I389N probably damaging Het
Tut4 T C 4: 108,406,417 (GRCm39) probably benign Het
Vezf1 T A 11: 87,965,520 (GRCm39) V254E probably damaging Het
Vmn1r122 T C 7: 20,867,227 (GRCm39) E276G probably benign Het
Vmn1r167 T A 7: 23,204,161 (GRCm39) N285I probably benign Het
Vmn2r45 T A 7: 8,484,480 (GRCm39) I442F probably benign Het
Vwa8 C A 14: 79,420,522 (GRCm39) A1741E probably damaging Het
Wdr20 T A 12: 110,704,668 (GRCm39) V69E probably damaging Het
Xkr4 T G 1: 3,287,074 (GRCm39) Q372P probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GGAAGCTTTCTCGGTCCTTG -3'
(R):5'- ATCAGCTACTGTCTACACCAGC -3'

Sequencing Primer
(F):5'- AGCTTTCTCGGTCCTTGTCAGC -3'
(R):5'- AGCTACTGTCTACACCAGCTACTG -3'
Posted On 2016-03-17