Mutagenetix > Incidental Mutations

Incidental Mutation 'R4868:Ube3b'

376314

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

042478-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4868 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114398427 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 216 (V216A)

Ref Sequence

ENSEMBL: ENSMUSP00000138723 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

Predicted Effect

probably benign
Transcript: ENSMUST00000074002
AA Change: F245L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: F245L

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169
AA Change: V216A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577
AA Change: V216A

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150630

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

99% (91/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	A	G	8: 105,710,097	*299W	probably null	Het
4933412E24Rik	G	A	15: 60,015,968	L208F	possibly damaging	Het
Abca8b	G	A	11: 109,974,512	A373V	probably benign	Het
Actn3	A	T	19: 4,864,454	W549R	probably benign	Het
Adamts4	C	T	1: 171,252,431		probably benign	Het
Adcy4	T	C	14: 55,773,722	I615V	probably benign	Het
Akap1	A	G	11: 88,844,553	S428P	possibly damaging	Het
Akap13	A	T	7: 75,743,504	R2476W	probably damaging	Het
Alx3	A	G	3: 107,600,627	S151G	possibly damaging	Het
Aoah	T	A	13: 20,914,981	Y243*	probably null	Het
Asap1	A	G	15: 64,094,181	V1025A	probably benign	Het
Atp8b1	A	T	18: 64,551,866	I728N	probably damaging	Het
Baz2b	C	A	2: 59,924,882	V1001L	possibly damaging	Het
Bmpr2	T	A	1: 59,870,456	S1030T	probably benign	Het
Cacna2d3	A	T	14: 28,956,786		probably null	Het
Casp3	A	T	8: 46,634,279	N87I	probably benign	Het
Ccdc171	T	A	4: 83,694,332	L995Q	probably damaging	Het
Ccdc80	T	A	16: 45,104,413	Y637N	probably damaging	Het
Ccr4	A	G	9: 114,492,833	F55L	probably benign	Het
Cmah	T	A	13: 24,464,264	V494E	probably damaging	Het
Cnot6l	A	G	5: 96,083,023	Y362H	probably damaging	Het
Coq6	T	C	12: 84,370,952	V222A	probably damaging	Het
Ctdspl2	C	A	2: 121,993,398	T240N	possibly damaging	Het
D430041D05Rik	T	C	2: 104,255,409	T248A	possibly damaging	Het
Dctn6	A	T	8: 34,092,076		probably benign	Het
Dhx34	T	C	7: 16,199,802	D955G	probably benign	Het
Dnaaf5	A	G	5: 139,170,186	M541V	probably benign	Het
Dnah17	A	T	11: 118,108,212	S912T	probably benign	Het
Dnah2	A	T	11: 69,463,648	V2248E	probably damaging	Het
Dysf	T	C	6: 84,179,693	W1502R	probably damaging	Het
Dzip1	A	T	14: 118,877,214	V843E	probably damaging	Het
Esp23	G	T	17: 39,074,024	T27K	probably benign	Het
Esp3	A	T	17: 40,633,529	M21L	possibly damaging	Het
Fam43b	T	A	4: 138,395,797	T71S	probably benign	Het
Fam46b	A	G	4: 133,486,082		probably null	Het
Fpgs	G	A	2: 32,692,661	R63C	probably damaging	Het
H2-M11	G	T	17: 36,548,919	W268L	probably damaging	Het
Inpp5b	T	C	4: 124,751,410	S210P	probably damaging	Het
Itsn1	T	A	16: 91,785,317	S51T	probably damaging	Het
Kctd2	G	A	11: 115,429,379	V246I	probably damaging	Het
Krt75	C	T	15: 101,568,121	G403E	probably damaging	Het
Lamp3	T	A	16: 19,701,290	T48S	probably benign	Het
Lyzl4	C	A	9: 121,583,009	V114L	probably damaging	Het
Maml3	C	A	3: 52,103,924	E74*	probably null	Het
Map2k7	G	A	8: 4,247,751		probably benign	Het
Mapk8ip3	A	G	17: 24,901,415	V883A	probably benign	Het
Mbtps1	C	T	8: 119,508,928	V1004I	probably benign	Het
Metap1	G	T	3: 138,483,089	H48Q	probably damaging	Het
Mical2	T	A	7: 112,318,624	V396E	probably damaging	Het
Mks1	T	A	11: 87,853,723		probably benign	Het
Ndst1	T	C	18: 60,695,476	T669A	probably benign	Het
Obox3	T	C	7: 15,627,310	K10R	probably damaging	Het
Olfr1014	T	G	2: 85,776,626	V14G	possibly damaging	Het
Olfr1318	T	A	2: 112,156,571	S207T	probably damaging	Het
Olfr711	C	T	7: 106,971,767	M192I	probably benign	Het
Opn3	T	C	1: 175,663,561	Y302C	probably damaging	Het
Pdzph1	A	T	17: 58,974,756	V177D	probably benign	Het
Pex5l	T	A	3: 32,952,490	I577F	probably damaging	Het
Pmpcb	T	A	5: 21,748,853	Y366*	probably null	Het
Prr14l	A	T	5: 32,829,937	M738K	probably benign	Het
Prx	T	C	7: 27,517,579	S641P	probably benign	Het
Ptchd3	A	G	11: 121,831,057	Y252C	possibly damaging	Het
Reg3a	A	G	6: 78,381,900	E27G	probably damaging	Het
Ripor2	A	G	13: 24,694,141	T300A	possibly damaging	Het
Sdf4	T	A	4: 156,009,185	S259T	probably damaging	Het
Sike1	A	G	3: 102,997,414		probably null	Het
Sis	T	G	3: 72,943,548	I606L	probably benign	Het
Slc30a9	T	C	5: 67,324,683	I94T	probably benign	Het
Slc5a4a	T	C	10: 76,178,231	I424T	probably damaging	Het
Spx	C	T	6: 142,416,390	R72*	probably null	Het
St7	C	A	6: 17,819,266	N56K	probably damaging	Het
Tcte2	C	A	17: 13,728,008	G3V	probably damaging	Het
Tgfb3	T	C	12: 86,062,181	D258G	probably benign	Het
Timeless	G	T	10: 128,247,361	G659V	probably benign	Het
Tnn	T	C	1: 160,130,873	R467G	possibly damaging	Het
Tor1b	T	C	2: 30,956,577		probably null	Het
Trank1	T	A	9: 111,365,641	L911Q	probably damaging	Het
Ttll2	C	T	17: 7,351,599	V310I	probably benign	Het
Ttyh3	A	T	5: 140,629,466	I389N	probably damaging	Het
Vezf1	T	A	11: 88,074,694	V254E	probably damaging	Het
Vmn1r122	T	C	7: 21,133,302	E276G	probably benign	Het
Vmn1r167	T	A	7: 23,504,736	N285I	probably benign	Het
Vmn2r45	T	A	7: 8,481,481	I442F	probably benign	Het
Vwa8	C	A	14: 79,183,082	A1741E	probably damaging	Het
Wdr20	T	A	12: 110,738,234	V69E	probably damaging	Het
Xkr4	T	G	1: 3,216,851	Q372P	probably damaging	Het
Zcchc11	T	C	4: 108,549,220		probably benign	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- GGAAGCTTTCTCGGTCCTTG -3'
(R):5'- ATCAGCTACTGTCTACACCAGC -3'

Sequencing Primer
(F):5'- AGCTTTCTCGGTCCTTGTCAGC -3'
(R):5'- AGCTACTGTCTACACCAGCTACTG -3'

Posted On

2016-03-17