Incidental Mutation 'R0282:Itga2b'
ID37634
Institutional Source Beutler Lab
Gene Symbol Itga2b
Ensembl Gene ENSMUSG00000034664
Gene Nameintegrin alpha 2b
Synonymsplatelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41
MMRRC Submission 038504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R0282 (G1)
Quality Score187
Status Validated
Chromosome11
Chromosomal Location102453297-102470122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 102460846 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 551 (V551G)
Ref Sequence ENSEMBL: ENSMUSP00000099375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103086]
Predicted Effect probably damaging
Transcript: ENSMUST00000103086
AA Change: V551G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664
AA Change: V551G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Int_alpha 46 103 2.34e-10 SMART
Int_alpha 261 311 1.3e-3 SMART
Int_alpha 315 376 4.9e-13 SMART
Int_alpha 382 438 4.34e-14 SMART
Int_alpha 443 494 4.05e-5 SMART
low complexity region 552 567 N/A INTRINSIC
SCOP:d1m1xa2 635 770 1e-48 SMART
SCOP:d1m1xa3 775 995 3e-66 SMART
Pfam:Integrin_alpha 1015 1029 5.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174900
Meta Mutation Damage Score 0.3391 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
1700123L14Rik T C 6: 96,164,816 T416A probably benign Het
Afap1l2 A G 19: 56,916,221 S549P possibly damaging Het
Alcam A T 16: 52,295,741 C157S probably damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Ano8 G A 8: 71,480,614 probably benign Het
Atr T C 9: 95,862,798 V56A probably benign Het
Aurkc T A 7: 7,002,428 probably null Het
Bnip3 T C 7: 138,898,030 D76G probably damaging Het
Cbr1 A G 16: 93,610,134 E246G possibly damaging Het
Ccdc157 G T 11: 4,146,708 A449D probably damaging Het
Ces3b T A 8: 105,083,851 V26D probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crk G T 11: 75,703,369 G261C probably damaging Het
Ctbp1 A G 5: 33,250,856 probably null Het
Ctnna1 G A 18: 35,244,122 V572I possibly damaging Het
D430041D05Rik T C 2: 104,201,244 Y1669C probably damaging Het
Dnah8 T C 17: 30,736,156 F2053S probably damaging Het
Dner G A 1: 84,405,965 T566M probably damaging Het
Dner A G 1: 84,445,380 probably benign Het
Edrf1 T C 7: 133,644,022 V223A probably benign Het
Fam169a A G 13: 97,097,715 probably benign Het
Fbxl3 G A 14: 103,095,225 H106Y probably damaging Het
Fiz1 A G 7: 5,009,201 V106A probably benign Het
Gapvd1 T A 2: 34,688,960 R654* probably null Het
Gm7589 G A 9: 59,146,005 noncoding transcript Het
Ifi202b A T 1: 173,977,360 S9T probably benign Het
Ipmk G C 10: 71,372,831 S149T probably benign Het
Irgm2 A G 11: 58,219,519 E24G probably benign Het
Itgad C T 7: 128,189,978 probably benign Het
Kcnh8 T A 17: 52,725,851 F55L probably damaging Het
Kdr G A 5: 75,950,100 probably benign Het
Krt35 T C 11: 100,095,747 Y147C probably damaging Het
Lamc1 A G 1: 153,255,312 F298L probably benign Het
Lrrk2 T C 15: 91,778,414 probably benign Het
Matn1 T C 4: 130,945,927 S69P probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Msto1 A G 3: 88,911,577 V257A possibly damaging Het
Mybpc3 G C 2: 91,124,024 probably benign Het
Mycn A G 12: 12,937,313 V361A probably benign Het
Myo10 A G 15: 25,793,167 T1277A probably damaging Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Olfr1199 G A 2: 88,756,456 T73I probably damaging Het
Olfr1510 A G 14: 52,410,263 V203A possibly damaging Het
Olfr267 A G 4: 58,785,344 I126T probably damaging Het
Olfr504 T A 7: 108,565,477 Q106L probably damaging Het
Otog C T 7: 46,277,493 T1222I possibly damaging Het
P4ha1 C T 10: 59,337,148 T23M probably damaging Het
Pld1 A T 3: 28,078,273 I537F probably benign Het
Plekhn1 A G 4: 156,228,323 probably benign Het
Pxdn C A 12: 29,984,440 S8* probably null Het
Rnf135 A T 11: 80,193,958 I186F probably damaging Het
Rock2 T C 12: 16,977,886 probably benign Het
Rph3a C A 5: 120,963,910 G88* probably null Het
Sarm1 G A 11: 78,474,980 Q740* probably null Het
Setd1b C A 5: 123,161,017 probably benign Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Slc2a4 A T 11: 69,946,355 V85E probably damaging Het
Swi5 A G 2: 32,280,754 Y54H probably damaging Het
Sycp1 A G 3: 102,915,795 probably benign Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tmem67 G A 4: 12,087,930 T72M probably damaging Het
Tor1a A G 2: 30,967,725 Y44H possibly damaging Het
Ttll5 T C 12: 85,996,053 Y1128H probably benign Het
Usp40 G A 1: 87,980,958 probably benign Het
Vmn2r18 A T 5: 151,585,203 M152K probably benign Het
Xirp2 T A 2: 67,513,380 D1988E probably damaging Het
Zfp420 A G 7: 29,875,680 I442V probably benign Het
Zyx A G 6: 42,356,005 E363G probably damaging Het
Other mutations in Itga2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Itga2b APN 11 102455583 missense probably damaging 1.00
IGL02197:Itga2b APN 11 102466319 missense probably benign 0.19
IGL02349:Itga2b APN 11 102461363 missense probably damaging 0.98
IGL02711:Itga2b APN 11 102465725 missense possibly damaging 0.53
R0349:Itga2b UTSW 11 102467426 missense probably damaging 0.98
R0384:Itga2b UTSW 11 102465362 splice site probably null
R0403:Itga2b UTSW 11 102467326 critical splice donor site probably null
R0452:Itga2b UTSW 11 102465953 intron probably null
R0535:Itga2b UTSW 11 102457533 missense possibly damaging 0.65
R1412:Itga2b UTSW 11 102457005 missense probably benign 0.00
R1517:Itga2b UTSW 11 102466325 nonsense probably null
R1615:Itga2b UTSW 11 102460137 critical splice donor site probably null
R1716:Itga2b UTSW 11 102460777 missense probably benign 0.30
R1953:Itga2b UTSW 11 102458183 missense probably benign 0.18
R2001:Itga2b UTSW 11 102467339 missense probably benign
R2216:Itga2b UTSW 11 102467866 missense probably benign 0.35
R4193:Itga2b UTSW 11 102469685 missense probably benign 0.01
R4770:Itga2b UTSW 11 102460756 missense probably damaging 1.00
R4805:Itga2b UTSW 11 102467866 missense probably benign 0.00
R4880:Itga2b UTSW 11 102457722 intron probably benign
R4906:Itga2b UTSW 11 102461159 missense probably benign 0.43
R5112:Itga2b UTSW 11 102458191 missense probably damaging 0.99
R5362:Itga2b UTSW 11 102461135 missense probably damaging 0.99
R5739:Itga2b UTSW 11 102465909 missense probably benign 0.14
R5761:Itga2b UTSW 11 102466274 missense probably benign 0.00
R5840:Itga2b UTSW 11 102461331 missense probably damaging 1.00
R5851:Itga2b UTSW 11 102457601 intron probably benign
R6239:Itga2b UTSW 11 102465318 missense possibly damaging 0.61
R6491:Itga2b UTSW 11 102459869 splice site probably null
R7426:Itga2b UTSW 11 102456294 missense probably benign 0.01
R7635:Itga2b UTSW 11 102461756 missense probably damaging 1.00
R7664:Itga2b UTSW 11 102460840 missense probably damaging 1.00
R7832:Itga2b UTSW 11 102457282 missense probably damaging 0.98
R7915:Itga2b UTSW 11 102457282 missense probably damaging 0.98
R8120:Itga2b UTSW 11 102469542 missense probably damaging 0.98
R8254:Itga2b UTSW 11 102467386 missense probably benign 0.16
R8296:Itga2b UTSW 11 102461159 missense possibly damaging 0.79
Z1177:Itga2b UTSW 11 102467076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCCATGCAATACCACGGCAG -3'
(R):5'- TGGGAGCCACAGGACACAACATTC -3'

Sequencing Primer
(F):5'- ACACGTTGAGGCTTAGCAC -3'
(R):5'- ACATTCCTCAGAAGCTGCG -3'
Posted On2013-05-23