Incidental Mutation 'R4868:Mks1'
ID376342
Institutional Source Beutler Lab
Gene Symbol Mks1
Ensembl Gene ENSMUSG00000034121
Gene NameMeckel syndrome, type 1
SynonymsB8d3
MMRRC Submission 042478-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4868 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87853215-87863803 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 87853723 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038196]
Predicted Effect probably benign
Transcript: ENSMUST00000038196
SMART Domains Protein: ENSMUSP00000043790
Gene: ENSMUSG00000034121

DomainStartEndE-ValueType
low complexity region 163 170 N/A INTRINSIC
Pfam:B9-C2 316 496 1.8e-45 PFAM
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153729
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in this gene result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit polydactyly, heterotaxia, skeletal defects, and kidney cysts along with abnormal lung, kidney, liver, and heart morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,710,097 *299W probably null Het
4933412E24Rik G A 15: 60,015,968 L208F possibly damaging Het
Abca8b G A 11: 109,974,512 A373V probably benign Het
Actn3 A T 19: 4,864,454 W549R probably benign Het
Adamts4 C T 1: 171,252,431 probably benign Het
Adcy4 T C 14: 55,773,722 I615V probably benign Het
Akap1 A G 11: 88,844,553 S428P possibly damaging Het
Akap13 A T 7: 75,743,504 R2476W probably damaging Het
Alx3 A G 3: 107,600,627 S151G possibly damaging Het
Aoah T A 13: 20,914,981 Y243* probably null Het
Asap1 A G 15: 64,094,181 V1025A probably benign Het
Atp8b1 A T 18: 64,551,866 I728N probably damaging Het
Baz2b C A 2: 59,924,882 V1001L possibly damaging Het
Bmpr2 T A 1: 59,870,456 S1030T probably benign Het
Cacna2d3 A T 14: 28,956,786 probably null Het
Casp3 A T 8: 46,634,279 N87I probably benign Het
Ccdc171 T A 4: 83,694,332 L995Q probably damaging Het
Ccdc80 T A 16: 45,104,413 Y637N probably damaging Het
Ccr4 A G 9: 114,492,833 F55L probably benign Het
Cmah T A 13: 24,464,264 V494E probably damaging Het
Cnot6l A G 5: 96,083,023 Y362H probably damaging Het
Coq6 T C 12: 84,370,952 V222A probably damaging Het
Ctdspl2 C A 2: 121,993,398 T240N possibly damaging Het
D430041D05Rik T C 2: 104,255,409 T248A possibly damaging Het
Dctn6 A T 8: 34,092,076 probably benign Het
Dhx34 T C 7: 16,199,802 D955G probably benign Het
Dnaaf5 A G 5: 139,170,186 M541V probably benign Het
Dnah17 A T 11: 118,108,212 S912T probably benign Het
Dnah2 A T 11: 69,463,648 V2248E probably damaging Het
Dysf T C 6: 84,179,693 W1502R probably damaging Het
Dzip1 A T 14: 118,877,214 V843E probably damaging Het
Esp23 G T 17: 39,074,024 T27K probably benign Het
Esp3 A T 17: 40,633,529 M21L possibly damaging Het
Fam43b T A 4: 138,395,797 T71S probably benign Het
Fam46b A G 4: 133,486,082 probably null Het
Fpgs G A 2: 32,692,661 R63C probably damaging Het
H2-M11 G T 17: 36,548,919 W268L probably damaging Het
Inpp5b T C 4: 124,751,410 S210P probably damaging Het
Itsn1 T A 16: 91,785,317 S51T probably damaging Het
Kctd2 G A 11: 115,429,379 V246I probably damaging Het
Krt75 C T 15: 101,568,121 G403E probably damaging Het
Lamp3 T A 16: 19,701,290 T48S probably benign Het
Lyzl4 C A 9: 121,583,009 V114L probably damaging Het
Maml3 C A 3: 52,103,924 E74* probably null Het
Map2k7 G A 8: 4,247,751 probably benign Het
Mapk8ip3 A G 17: 24,901,415 V883A probably benign Het
Mbtps1 C T 8: 119,508,928 V1004I probably benign Het
Metap1 G T 3: 138,483,089 H48Q probably damaging Het
Mical2 T A 7: 112,318,624 V396E probably damaging Het
Ndst1 T C 18: 60,695,476 T669A probably benign Het
Obox3 T C 7: 15,627,310 K10R probably damaging Het
Olfr1014 T G 2: 85,776,626 V14G possibly damaging Het
Olfr1318 T A 2: 112,156,571 S207T probably damaging Het
Olfr711 C T 7: 106,971,767 M192I probably benign Het
Opn3 T C 1: 175,663,561 Y302C probably damaging Het
Pdzph1 A T 17: 58,974,756 V177D probably benign Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Pmpcb T A 5: 21,748,853 Y366* probably null Het
Prr14l A T 5: 32,829,937 M738K probably benign Het
Prx T C 7: 27,517,579 S641P probably benign Het
Ptchd3 A G 11: 121,831,057 Y252C possibly damaging Het
Reg3a A G 6: 78,381,900 E27G probably damaging Het
Ripor2 A G 13: 24,694,141 T300A possibly damaging Het
Sdf4 T A 4: 156,009,185 S259T probably damaging Het
Sike1 A G 3: 102,997,414 probably null Het
Sis T G 3: 72,943,548 I606L probably benign Het
Slc30a9 T C 5: 67,324,683 I94T probably benign Het
Slc5a4a T C 10: 76,178,231 I424T probably damaging Het
Spx C T 6: 142,416,390 R72* probably null Het
St7 C A 6: 17,819,266 N56K probably damaging Het
Tcte2 C A 17: 13,728,008 G3V probably damaging Het
Tgfb3 T C 12: 86,062,181 D258G probably benign Het
Timeless G T 10: 128,247,361 G659V probably benign Het
Tnn T C 1: 160,130,873 R467G possibly damaging Het
Tor1b T C 2: 30,956,577 probably null Het
Trank1 T A 9: 111,365,641 L911Q probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ttyh3 A T 5: 140,629,466 I389N probably damaging Het
Ube3b T C 5: 114,398,427 V216A probably benign Het
Vezf1 T A 11: 88,074,694 V254E probably damaging Het
Vmn1r122 T C 7: 21,133,302 E276G probably benign Het
Vmn1r167 T A 7: 23,504,736 N285I probably benign Het
Vmn2r45 T A 7: 8,481,481 I442F probably benign Het
Vwa8 C A 14: 79,183,082 A1741E probably damaging Het
Wdr20 T A 12: 110,738,234 V69E probably damaging Het
Xkr4 T G 1: 3,216,851 Q372P probably damaging Het
Zcchc11 T C 4: 108,549,220 probably benign Het
Other mutations in Mks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01799:Mks1 APN 11 87856863 missense probably benign 0.28
IGL02291:Mks1 APN 11 87859667 unclassified probably benign
IGL02406:Mks1 APN 11 87862785 missense probably benign 0.02
IGL02938:Mks1 APN 11 87862652 critical splice donor site probably null
IGL03094:Mks1 APN 11 87855465 splice site probably benign
R0389:Mks1 UTSW 11 87857928 missense probably benign
R0893:Mks1 UTSW 11 87856951 splice site probably benign
R1490:Mks1 UTSW 11 87862769 missense probably benign 0.02
R1514:Mks1 UTSW 11 87861111 missense probably benign 0.31
R2042:Mks1 UTSW 11 87856668 splice site probably benign
R4289:Mks1 UTSW 11 87856704 intron probably benign
R4757:Mks1 UTSW 11 87863024 makesense probably null
R5243:Mks1 UTSW 11 87856678 intron probably benign
R5708:Mks1 UTSW 11 87856839 missense probably benign 0.21
R5848:Mks1 UTSW 11 87856870 missense probably benign 0.00
R6289:Mks1 UTSW 11 87859659 critical splice donor site probably null
R6320:Mks1 UTSW 11 87855499 missense probably benign 0.00
R7205:Mks1 UTSW 11 87856602 missense probably benign 0.02
R7642:Mks1 UTSW 11 87856840 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCCACTGAAAGCTTCCAAGTAC -3'
(R):5'- ACCCCTGCCTTAGTCTCAAATG -3'

Sequencing Primer
(F):5'- TGAAAGCTTCCAAGTACACCTTTCAG -3'
(R):5'- GCCTTAGTCTCAAATGAATGTAGCG -3'
Posted On2016-03-17