Mutagenetix > Incidental Mutation

Incidental Mutation 'R4868:Ndst1'

376373

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

042478-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4868 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60695476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 669 (T669A)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

probably benign
Transcript: ENSMUST00000169273
AA Change: T669A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: T669A

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Meta Mutation Damage Score

0.0734

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

99% (91/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	A	G	8: 105,710,097	*299W	probably null	Het
4933412E24Rik	G	A	15: 60,015,968	L208F	possibly damaging	Het
Abca8b	G	A	11: 109,974,512	A373V	probably benign	Het
Actn3	A	T	19: 4,864,454	W549R	probably benign	Het
Adamts4	C	T	1: 171,252,431		probably benign	Het
Adcy4	T	C	14: 55,773,722	I615V	probably benign	Het
Akap1	A	G	11: 88,844,553	S428P	possibly damaging	Het
Akap13	A	T	7: 75,743,504	R2476W	probably damaging	Het
Alx3	A	G	3: 107,600,627	S151G	possibly damaging	Het
Aoah	T	A	13: 20,914,981	Y243*	probably null	Het
Asap1	A	G	15: 64,094,181	V1025A	probably benign	Het
Atp8b1	A	T	18: 64,551,866	I728N	probably damaging	Het
Baz2b	C	A	2: 59,924,882	V1001L	possibly damaging	Het
Bmpr2	T	A	1: 59,870,456	S1030T	probably benign	Het
Cacna2d3	A	T	14: 28,956,786		probably null	Het
Casp3	A	T	8: 46,634,279	N87I	probably benign	Het
Ccdc171	T	A	4: 83,694,332	L995Q	probably damaging	Het
Ccdc80	T	A	16: 45,104,413	Y637N	probably damaging	Het
Ccr4	A	G	9: 114,492,833	F55L	probably benign	Het
Cmah	T	A	13: 24,464,264	V494E	probably damaging	Het
Cnot6l	A	G	5: 96,083,023	Y362H	probably damaging	Het
Coq6	T	C	12: 84,370,952	V222A	probably damaging	Het
Ctdspl2	C	A	2: 121,993,398	T240N	possibly damaging	Het
D430041D05Rik	T	C	2: 104,255,409	T248A	possibly damaging	Het
Dctn6	A	T	8: 34,092,076		probably benign	Het
Dhx34	T	C	7: 16,199,802	D955G	probably benign	Het
Dnaaf5	A	G	5: 139,170,186	M541V	probably benign	Het
Dnah17	A	T	11: 118,108,212	S912T	probably benign	Het
Dnah2	A	T	11: 69,463,648	V2248E	probably damaging	Het
Dysf	T	C	6: 84,179,693	W1502R	probably damaging	Het
Dzip1	A	T	14: 118,877,214	V843E	probably damaging	Het
Esp23	G	T	17: 39,074,024	T27K	probably benign	Het
Esp3	A	T	17: 40,633,529	M21L	possibly damaging	Het
Fam43b	T	A	4: 138,395,797	T71S	probably benign	Het
Fam46b	A	G	4: 133,486,082		probably null	Het
Fpgs	G	A	2: 32,692,661	R63C	probably damaging	Het
H2-M11	G	T	17: 36,548,919	W268L	probably damaging	Het
Inpp5b	T	C	4: 124,751,410	S210P	probably damaging	Het
Itsn1	T	A	16: 91,785,317	S51T	probably damaging	Het
Kctd2	G	A	11: 115,429,379	V246I	probably damaging	Het
Krt75	C	T	15: 101,568,121	G403E	probably damaging	Het
Lamp3	T	A	16: 19,701,290	T48S	probably benign	Het
Lyzl4	C	A	9: 121,583,009	V114L	probably damaging	Het
Maml3	C	A	3: 52,103,924	E74*	probably null	Het
Map2k7	G	A	8: 4,247,751		probably benign	Het
Mapk8ip3	A	G	17: 24,901,415	V883A	probably benign	Het
Mbtps1	C	T	8: 119,508,928	V1004I	probably benign	Het
Metap1	G	T	3: 138,483,089	H48Q	probably damaging	Het
Mical2	T	A	7: 112,318,624	V396E	probably damaging	Het
Mks1	T	A	11: 87,853,723		probably benign	Het
Obox3	T	C	7: 15,627,310	K10R	probably damaging	Het
Olfr1014	T	G	2: 85,776,626	V14G	possibly damaging	Het
Olfr1318	T	A	2: 112,156,571	S207T	probably damaging	Het
Olfr711	C	T	7: 106,971,767	M192I	probably benign	Het
Opn3	T	C	1: 175,663,561	Y302C	probably damaging	Het
Pdzph1	A	T	17: 58,974,756	V177D	probably benign	Het
Pex5l	T	A	3: 32,952,490	I577F	probably damaging	Het
Pmpcb	T	A	5: 21,748,853	Y366*	probably null	Het
Prr14l	A	T	5: 32,829,937	M738K	probably benign	Het
Prx	T	C	7: 27,517,579	S641P	probably benign	Het
Ptchd3	A	G	11: 121,831,057	Y252C	possibly damaging	Het
Reg3a	A	G	6: 78,381,900	E27G	probably damaging	Het
Ripor2	A	G	13: 24,694,141	T300A	possibly damaging	Het
Sdf4	T	A	4: 156,009,185	S259T	probably damaging	Het
Sike1	A	G	3: 102,997,414		probably null	Het
Sis	T	G	3: 72,943,548	I606L	probably benign	Het
Slc30a9	T	C	5: 67,324,683	I94T	probably benign	Het
Slc5a4a	T	C	10: 76,178,231	I424T	probably damaging	Het
Spx	C	T	6: 142,416,390	R72*	probably null	Het
St7	C	A	6: 17,819,266	N56K	probably damaging	Het
Tcte2	C	A	17: 13,728,008	G3V	probably damaging	Het
Tgfb3	T	C	12: 86,062,181	D258G	probably benign	Het
Timeless	G	T	10: 128,247,361	G659V	probably benign	Het
Tnn	T	C	1: 160,130,873	R467G	possibly damaging	Het
Tor1b	T	C	2: 30,956,577		probably null	Het
Trank1	T	A	9: 111,365,641	L911Q	probably damaging	Het
Ttll2	C	T	17: 7,351,599	V310I	probably benign	Het
Ttyh3	A	T	5: 140,629,466	I389N	probably damaging	Het
Ube3b	T	C	5: 114,398,427	V216A	probably benign	Het
Vezf1	T	A	11: 88,074,694	V254E	probably damaging	Het
Vmn1r122	T	C	7: 21,133,302	E276G	probably benign	Het
Vmn1r167	T	A	7: 23,504,736	N285I	probably benign	Het
Vmn2r45	T	A	7: 8,481,481	I442F	probably benign	Het
Vwa8	C	A	14: 79,183,082	A1741E	probably damaging	Het
Wdr20	T	A	12: 110,738,234	V69E	probably damaging	Het
Xkr4	T	G	1: 3,216,851	Q372P	probably damaging	Het
Zcchc11	T	C	4: 108,549,220		probably benign	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9526:Ndst1	UTSW	18	60705148	nonsense	probably null
R9552:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9651:Ndst1	UTSW	18	60700467	missense	probably damaging	0.96
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGAGTAACCAGACAGAGCCC -3'
(R):5'- ATCTGGGATAGGAGACTGCC -3'

Sequencing Primer
(F):5'- GAGCCCACCCCACCTCG -3'
(R):5'- TCAGAGCCAAGTCCTTGCTG -3'

Posted On

2016-03-17