Incidental Mutation 'R4868:Atp8b1'
ID376374
Institutional Source Beutler Lab
Gene Symbol Atp8b1
Ensembl Gene ENSMUSG00000039529
Gene NameATPase, class I, type 8B, member 1
SynonymsFIC1, Ic
MMRRC Submission 042478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4868 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location64528979-64661000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64551866 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 728 (I728N)
Ref Sequence ENSEMBL: ENSMUSP00000025482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025482]
Predicted Effect probably damaging
Transcript: ENSMUST00000025482
AA Change: I728N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: I728N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 65 144 5.3e-29 PFAM
Pfam:E1-E2_ATPase 146 413 6e-11 PFAM
Pfam:HAD 451 902 2.4e-21 PFAM
Pfam:Cation_ATPase 532 632 1e-12 PFAM
Pfam:PhoLip_ATPase_C 919 1173 7.3e-82 PFAM
low complexity region 1193 1207 N/A INTRINSIC
low complexity region 1221 1232 N/A INTRINSIC
Meta Mutation Damage Score 0.9136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,710,097 *299W probably null Het
4933412E24Rik G A 15: 60,015,968 L208F possibly damaging Het
Abca8b G A 11: 109,974,512 A373V probably benign Het
Actn3 A T 19: 4,864,454 W549R probably benign Het
Adamts4 C T 1: 171,252,431 probably benign Het
Adcy4 T C 14: 55,773,722 I615V probably benign Het
Akap1 A G 11: 88,844,553 S428P possibly damaging Het
Akap13 A T 7: 75,743,504 R2476W probably damaging Het
Alx3 A G 3: 107,600,627 S151G possibly damaging Het
Aoah T A 13: 20,914,981 Y243* probably null Het
Asap1 A G 15: 64,094,181 V1025A probably benign Het
Baz2b C A 2: 59,924,882 V1001L possibly damaging Het
Bmpr2 T A 1: 59,870,456 S1030T probably benign Het
Cacna2d3 A T 14: 28,956,786 probably null Het
Casp3 A T 8: 46,634,279 N87I probably benign Het
Ccdc171 T A 4: 83,694,332 L995Q probably damaging Het
Ccdc80 T A 16: 45,104,413 Y637N probably damaging Het
Ccr4 A G 9: 114,492,833 F55L probably benign Het
Cmah T A 13: 24,464,264 V494E probably damaging Het
Cnot6l A G 5: 96,083,023 Y362H probably damaging Het
Coq6 T C 12: 84,370,952 V222A probably damaging Het
Ctdspl2 C A 2: 121,993,398 T240N possibly damaging Het
D430041D05Rik T C 2: 104,255,409 T248A possibly damaging Het
Dctn6 A T 8: 34,092,076 probably benign Het
Dhx34 T C 7: 16,199,802 D955G probably benign Het
Dnaaf5 A G 5: 139,170,186 M541V probably benign Het
Dnah17 A T 11: 118,108,212 S912T probably benign Het
Dnah2 A T 11: 69,463,648 V2248E probably damaging Het
Dysf T C 6: 84,179,693 W1502R probably damaging Het
Dzip1 A T 14: 118,877,214 V843E probably damaging Het
Esp23 G T 17: 39,074,024 T27K probably benign Het
Esp3 A T 17: 40,633,529 M21L possibly damaging Het
Fam43b T A 4: 138,395,797 T71S probably benign Het
Fam46b A G 4: 133,486,082 probably null Het
Fpgs G A 2: 32,692,661 R63C probably damaging Het
H2-M11 G T 17: 36,548,919 W268L probably damaging Het
Inpp5b T C 4: 124,751,410 S210P probably damaging Het
Itsn1 T A 16: 91,785,317 S51T probably damaging Het
Kctd2 G A 11: 115,429,379 V246I probably damaging Het
Krt75 C T 15: 101,568,121 G403E probably damaging Het
Lamp3 T A 16: 19,701,290 T48S probably benign Het
Lyzl4 C A 9: 121,583,009 V114L probably damaging Het
Maml3 C A 3: 52,103,924 E74* probably null Het
Map2k7 G A 8: 4,247,751 probably benign Het
Mapk8ip3 A G 17: 24,901,415 V883A probably benign Het
Mbtps1 C T 8: 119,508,928 V1004I probably benign Het
Metap1 G T 3: 138,483,089 H48Q probably damaging Het
Mical2 T A 7: 112,318,624 V396E probably damaging Het
Mks1 T A 11: 87,853,723 probably benign Het
Ndst1 T C 18: 60,695,476 T669A probably benign Het
Obox3 T C 7: 15,627,310 K10R probably damaging Het
Olfr1014 T G 2: 85,776,626 V14G possibly damaging Het
Olfr1318 T A 2: 112,156,571 S207T probably damaging Het
Olfr711 C T 7: 106,971,767 M192I probably benign Het
Opn3 T C 1: 175,663,561 Y302C probably damaging Het
Pdzph1 A T 17: 58,974,756 V177D probably benign Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Pmpcb T A 5: 21,748,853 Y366* probably null Het
Prr14l A T 5: 32,829,937 M738K probably benign Het
Prx T C 7: 27,517,579 S641P probably benign Het
Ptchd3 A G 11: 121,831,057 Y252C possibly damaging Het
Reg3a A G 6: 78,381,900 E27G probably damaging Het
Ripor2 A G 13: 24,694,141 T300A possibly damaging Het
Sdf4 T A 4: 156,009,185 S259T probably damaging Het
Sike1 A G 3: 102,997,414 probably null Het
Sis T G 3: 72,943,548 I606L probably benign Het
Slc30a9 T C 5: 67,324,683 I94T probably benign Het
Slc5a4a T C 10: 76,178,231 I424T probably damaging Het
Spx C T 6: 142,416,390 R72* probably null Het
St7 C A 6: 17,819,266 N56K probably damaging Het
Tcte2 C A 17: 13,728,008 G3V probably damaging Het
Tgfb3 T C 12: 86,062,181 D258G probably benign Het
Timeless G T 10: 128,247,361 G659V probably benign Het
Tnn T C 1: 160,130,873 R467G possibly damaging Het
Tor1b T C 2: 30,956,577 probably null Het
Trank1 T A 9: 111,365,641 L911Q probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ttyh3 A T 5: 140,629,466 I389N probably damaging Het
Ube3b T C 5: 114,398,427 V216A probably benign Het
Vezf1 T A 11: 88,074,694 V254E probably damaging Het
Vmn1r122 T C 7: 21,133,302 E276G probably benign Het
Vmn1r167 T A 7: 23,504,736 N285I probably benign Het
Vmn2r45 T A 7: 8,481,481 I442F probably benign Het
Vwa8 C A 14: 79,183,082 A1741E probably damaging Het
Wdr20 T A 12: 110,738,234 V69E probably damaging Het
Xkr4 T G 1: 3,216,851 Q372P probably damaging Het
Zcchc11 T C 4: 108,549,220 probably benign Het
Other mutations in Atp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Atp8b1 APN 18 64564430 missense probably benign 0.23
IGL00907:Atp8b1 APN 18 64561705 missense possibly damaging 0.95
IGL00962:Atp8b1 APN 18 64531444 missense probably damaging 1.00
IGL01433:Atp8b1 APN 18 64573519 missense probably benign 0.00
IGL01525:Atp8b1 APN 18 64539252 nonsense probably null
IGL01645:Atp8b1 APN 18 64546113 missense probably benign 0.06
IGL02008:Atp8b1 APN 18 64538695 splice site probably benign
IGL02227:Atp8b1 APN 18 64562190 missense probably benign
IGL02231:Atp8b1 APN 18 64550384 missense possibly damaging 0.94
IGL02326:Atp8b1 APN 18 64538583 missense probably damaging 0.99
IGL02562:Atp8b1 APN 18 64581986 missense probably benign
IGL02929:Atp8b1 APN 18 64561662 missense possibly damaging 0.63
enchilada UTSW 18 64545989 critical splice donor site probably null
PIT4520001:Atp8b1 UTSW 18 64568180 missense probably benign 0.34
PIT4696001:Atp8b1 UTSW 18 64539270 missense possibly damaging 0.93
R0144:Atp8b1 UTSW 18 64571374 splice site probably benign
R0193:Atp8b1 UTSW 18 64561636 missense probably benign
R0277:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0308:Atp8b1 UTSW 18 64545244 nonsense probably null
R0323:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0403:Atp8b1 UTSW 18 64540310 missense probably damaging 1.00
R0601:Atp8b1 UTSW 18 64571653 splice site probably null
R0614:Atp8b1 UTSW 18 64533587 splice site probably benign
R0883:Atp8b1 UTSW 18 64564541 missense probably benign 0.44
R1077:Atp8b1 UTSW 18 64573262 nonsense probably null
R1292:Atp8b1 UTSW 18 64571021 missense probably damaging 0.99
R1494:Atp8b1 UTSW 18 64564526 missense probably damaging 1.00
R1522:Atp8b1 UTSW 18 64550432 missense probably benign 0.00
R1534:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1535:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1536:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1537:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1650:Atp8b1 UTSW 18 64571549 splice site probably benign
R1772:Atp8b1 UTSW 18 64573492 missense possibly damaging 0.88
R2016:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2017:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2043:Atp8b1 UTSW 18 64605200 missense possibly damaging 0.94
R2223:Atp8b1 UTSW 18 64564357 missense possibly damaging 0.88
R3052:Atp8b1 UTSW 18 64553108 missense probably benign 0.04
R3694:Atp8b1 UTSW 18 64533721 missense possibly damaging 0.81
R3738:Atp8b1 UTSW 18 64533729 splice site probably benign
R4211:Atp8b1 UTSW 18 64553047 missense probably damaging 1.00
R4362:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R4560:Atp8b1 UTSW 18 64556879 nonsense probably null
R4560:Atp8b1 UTSW 18 64568247 missense probably benign 0.11
R4562:Atp8b1 UTSW 18 64556891 missense probably damaging 1.00
R4615:Atp8b1 UTSW 18 64553099 missense probably null
R4676:Atp8b1 UTSW 18 64538678 missense probably benign 0.01
R4738:Atp8b1 UTSW 18 64545180 missense probably benign 0.31
R4774:Atp8b1 UTSW 18 64533659 missense possibly damaging 0.49
R4808:Atp8b1 UTSW 18 64561711 missense probably benign 0.01
R5162:Atp8b1 UTSW 18 64561662 missense possibly damaging 0.63
R5289:Atp8b1 UTSW 18 64546087 missense possibly damaging 0.51
R5328:Atp8b1 UTSW 18 64531391 missense probably benign 0.00
R5400:Atp8b1 UTSW 18 64545989 critical splice donor site probably null
R5587:Atp8b1 UTSW 18 64539210 missense probably damaging 1.00
R5623:Atp8b1 UTSW 18 64546094 missense possibly damaging 0.85
R5651:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5652:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5653:Atp8b1 UTSW 18 64545197 missense probably damaging 1.00
R5667:Atp8b1 UTSW 18 64581923 missense probably damaging 1.00
R5689:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R6008:Atp8b1 UTSW 18 64577616 missense probably damaging 1.00
R6315:Atp8b1 UTSW 18 64531479 missense probably damaging 0.97
R6759:Atp8b1 UTSW 18 64546090 missense probably benign 0.00
R6850:Atp8b1 UTSW 18 64556852 missense possibly damaging 0.94
R7255:Atp8b1 UTSW 18 64556868 missense probably damaging 1.00
R7606:Atp8b1 UTSW 18 64555115 missense probably damaging 1.00
R7635:Atp8b1 UTSW 18 64573305 missense possibly damaging 0.59
R7639:Atp8b1 UTSW 18 64564543 missense possibly damaging 0.91
R7698:Atp8b1 UTSW 18 64571022 missense probably benign 0.03
R7727:Atp8b1 UTSW 18 64545275 missense probably damaging 1.00
R7779:Atp8b1 UTSW 18 64541382 missense probably damaging 1.00
R7785:Atp8b1 UTSW 18 64556850 missense probably damaging 1.00
X0025:Atp8b1 UTSW 18 64571405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGATTTGACCAGGGTGGAC -3'
(R):5'- CCAGCTTTTGATGACAGTGC -3'

Sequencing Primer
(F):5'- ACTGGACTAGGAGGAGGGTTTTTAAG -3'
(R):5'- TGATGACAGTGCCAGCCATTG -3'
Posted On2016-03-17