Incidental Mutation 'R4869:Nrxn3'
ID376444
Institutional Source Beutler Lab
Gene Symbol Nrxn3
Ensembl Gene ENSMUSG00000066392
Gene Nameneurexin III
Synonyms4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta
MMRRC Submission 042479-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4869 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location88722876-90334935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88795582 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 133 (E133G)
Ref Sequence ENSEMBL: ENSMUSP00000127407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000190626]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110138
Predicted Effect possibly damaging
Transcript: ENSMUST00000163134
AA Change: E133G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: E133G

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 843 4.87e-26 SMART
LamG 891 1027 7.08e-37 SMART
EGF 1052 1086 1.99e1 SMART
LamG 1114 1271 1.14e-17 SMART
low complexity region 1312 1328 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1499 1514 N/A INTRINSIC
4.1m 1517 1535 4.38e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164072
Predicted Effect possibly damaging
Transcript: ENSMUST00000167103
AA Change: E133G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392
AA Change: E133G

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 834 5.76e-28 SMART
LamG 882 1018 7.08e-37 SMART
EGF 1043 1077 1.99e1 SMART
LamG 1105 1262 1.14e-17 SMART
low complexity region 1303 1319 N/A INTRINSIC
low complexity region 1354 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190030
Predicted Effect probably benign
Transcript: ENSMUST00000190626
SMART Domains Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392

DomainStartEndE-ValueType
LamG 94 246 2.1e-43 SMART
EGF 273 307 2e-4 SMART
LamG 332 470 3.1e-28 SMART
LamG 518 654 4.4e-39 SMART
EGF 688 722 9.6e-2 SMART
LamG 750 877 1.1e-22 SMART
low complexity region 918 934 N/A INTRINSIC
low complexity region 972 1000 N/A INTRINSIC
Meta Mutation Damage Score 0.0646 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,254,205 K943N probably damaging Het
Abca13 G A 11: 9,315,434 probably null Het
Ankub1 A G 3: 57,690,330 L73P probably damaging Het
Birc6 A G 17: 74,586,012 I982V probably benign Het
Cabyr G T 18: 12,751,818 *454L probably null Het
Ccdc57 C T 11: 120,903,518 probably null Het
Cd209c A G 8: 3,944,077 F128L probably benign Het
Cdh23 A T 10: 60,376,934 I1566N probably damaging Het
Cdon T C 9: 35,452,904 V106A possibly damaging Het
Cebpa G T 7: 35,119,821 G135C probably damaging Het
Cfap65 A G 1: 74,919,261 S896P probably benign Het
Ciz1 T C 2: 32,364,235 S63P probably damaging Het
Clybl G A 14: 122,384,206 V269M probably damaging Het
Ctnnb1 G T 9: 120,952,994 V358L possibly damaging Het
Cwh43 G T 5: 73,428,673 probably null Het
Cyp2d10 G A 15: 82,403,766 R379C probably benign Het
Dab2ip C A 2: 35,720,037 R727S probably damaging Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dock1 A T 7: 134,734,071 I65F probably damaging Het
Ercc2 T C 7: 19,386,807 V155A probably damaging Het
Exph5 A C 9: 53,376,239 D1540A possibly damaging Het
Fat3 T A 9: 16,377,477 H250L probably damaging Het
Fbxw10 C A 11: 62,862,731 A517E probably damaging Het
Furin A T 7: 80,396,979 N176K probably damaging Het
Gabrb3 A G 7: 57,792,459 probably benign Het
Gabrg2 A T 11: 41,920,404 S305T probably damaging Het
Gas6 G T 8: 13,475,086 S299R possibly damaging Het
Gga3 G T 11: 115,586,285 probably benign Het
Gle1 A G 2: 29,936,020 E37G possibly damaging Het
Gm6614 T C 6: 141,987,766 D431G probably damaging Het
Gm7964 A G 7: 83,756,142 D80G possibly damaging Het
Gne C T 4: 44,055,204 probably null Het
Grid2 G T 6: 64,429,740 G695W probably damaging Het
H2-M10.6 A T 17: 36,812,533 M40L probably benign Het
Hectd4 G T 5: 121,322,672 V905L possibly damaging Het
Isyna1 C A 8: 70,596,762 S441R possibly damaging Het
Kcnh3 C T 15: 99,242,032 S933L probably benign Het
Knl1 T C 2: 119,072,351 I1511T possibly damaging Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Lipo4 C T 19: 33,501,553 probably null Het
Llgl1 T A 11: 60,707,210 L360* probably null Het
Map2k5 G A 9: 63,322,243 R169* probably null Het
Muc19 A T 15: 91,897,716 noncoding transcript Het
Muc4 G A 16: 32,754,836 probably benign Het
Myh4 A G 11: 67,252,664 E1074G probably damaging Het
Naip5 C T 13: 100,245,131 G210E probably damaging Het
Nalcn A G 14: 123,599,884 S23P probably benign Het
Nepro T A 16: 44,730,173 M176K probably damaging Het
Nlrp6 G A 7: 140,924,093 C704Y probably damaging Het
Notch1 A G 2: 26,471,179 S1100P probably benign Het
Parp9 T C 16: 35,956,904 L406S probably damaging Het
Peak1 G T 9: 56,227,592 A155D probably benign Het
Piezo1 G A 8: 122,487,545 H1628Y probably benign Het
Piwil2 A G 14: 70,395,362 V587A probably benign Het
Pkn2 A G 3: 142,803,618 Y722H probably damaging Het
Plch2 A T 4: 154,989,428 I834K probably benign Het
Pld1 A G 3: 28,109,802 T795A possibly damaging Het
Plekhh1 A G 12: 79,050,386 S103G probably benign Het
Ppl T C 16: 5,104,889 Y246C probably damaging Het
Prpf40b G A 15: 99,309,845 probably benign Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp3 T A 4: 59,524,443 I28F possibly damaging Het
Ptrh2 A T 11: 86,689,805 K83* probably null Het
Rai1 T C 11: 60,186,762 S551P probably damaging Het
Rapgefl1 A T 11: 98,851,109 Q633L probably damaging Het
Rb1cc1 T C 1: 6,215,021 probably benign Het
Rif1 T A 2: 52,093,611 probably benign Het
Rnf141 A G 7: 110,825,350 Y101H probably damaging Het
Rnf219 A G 14: 104,478,816 I707T probably damaging Het
Rttn T A 18: 89,043,014 L1102* probably null Het
Sall4 G A 2: 168,755,717 S401F probably damaging Het
Sec11c T C 18: 65,801,470 I36T probably benign Het
Sel1l A G 12: 91,814,054 probably benign Het
Setd1a T C 7: 127,797,604 probably benign Het
Sez6l2 C T 7: 126,961,842 P433L probably benign Het
Sgf29 T C 7: 126,649,375 probably benign Het
Slc47a1 A G 11: 61,362,694 V305A probably benign Het
Sun2 T C 15: 79,728,386 probably benign Het
Tecta T C 9: 42,375,534 S609G probably benign Het
Tex45 G A 8: 3,487,148 S498N probably damaging Het
Tmprss6 T A 15: 78,443,680 probably null Het
Tns1 T C 1: 73,952,615 H968R probably benign Het
Tomm34 G A 2: 164,054,717 A270V probably damaging Het
Tpo T C 12: 30,103,365 K330R probably benign Het
Ttn T A 2: 76,712,493 Y33383F probably damaging Het
Unc13c G T 9: 73,680,434 A1439D probably benign Het
Vcp C T 4: 42,993,691 R147H probably benign Het
Vps13d A G 4: 145,128,042 L2272P probably damaging Het
Wdfy3 A G 5: 101,894,921 L1988P probably damaging Het
Wwc2 A G 8: 47,920,678 F51S probably damaging Het
Zfp454 C T 11: 50,873,153 C373Y probably damaging Het
Zfp853 A T 5: 143,288,293 V473E probably damaging Het
Zfp959 A T 17: 55,897,228 R85S possibly damaging Het
Other mutations in Nrxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrxn3 APN 12 90204592 missense probably damaging 1.00
IGL00961:Nrxn3 APN 12 90204546 missense possibly damaging 0.95
IGL01073:Nrxn3 APN 12 89254740 missense probably benign 0.25
IGL01338:Nrxn3 APN 12 89255034 missense possibly damaging 0.86
IGL01377:Nrxn3 APN 12 89533012 critical splice donor site probably null
IGL01409:Nrxn3 APN 12 89510358 missense probably damaging 1.00
IGL01764:Nrxn3 APN 12 90204750 missense possibly damaging 0.48
IGL02063:Nrxn3 APN 12 88795795 missense possibly damaging 0.86
IGL02171:Nrxn3 APN 12 89193163 missense probably damaging 1.00
IGL02309:Nrxn3 APN 12 89976407 missense probably damaging 0.99
IGL02340:Nrxn3 APN 12 90204628 missense possibly damaging 0.82
IGL02343:Nrxn3 APN 12 88795353 missense probably damaging 1.00
IGL02600:Nrxn3 APN 12 89511912 splice site probably benign
IGL02735:Nrxn3 APN 12 89254854 missense probably benign 0.16
IGL03061:Nrxn3 APN 12 89511928 nonsense probably null
IGL03206:Nrxn3 APN 12 89260508 missense possibly damaging 0.88
IGL03337:Nrxn3 APN 12 89255020 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0144:Nrxn3 UTSW 12 89348392 missense probably damaging 1.00
R0334:Nrxn3 UTSW 12 89813642 critical splice donor site probably null
R0531:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R0840:Nrxn3 UTSW 12 90331793 missense possibly damaging 0.68
R1324:Nrxn3 UTSW 12 89254696 missense possibly damaging 0.89
R1438:Nrxn3 UTSW 12 90332135 missense probably damaging 1.00
R1484:Nrxn3 UTSW 12 89254777 missense probably damaging 0.99
R1621:Nrxn3 UTSW 12 88795710 missense probably benign
R1637:Nrxn3 UTSW 12 89354468 missense possibly damaging 0.94
R1659:Nrxn3 UTSW 12 90332391 missense probably damaging 1.00
R1746:Nrxn3 UTSW 12 89255019 missense possibly damaging 0.63
R1801:Nrxn3 UTSW 12 90283582 missense probably damaging 1.00
R1912:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R1940:Nrxn3 UTSW 12 89260381 missense probably damaging 0.98
R1993:Nrxn3 UTSW 12 89260411 missense possibly damaging 0.59
R2002:Nrxn3 UTSW 12 90332315 missense probably damaging 1.00
R2125:Nrxn3 UTSW 12 89260520 splice site probably null
R2179:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R2207:Nrxn3 UTSW 12 89348312 missense probably damaging 1.00
R2284:Nrxn3 UTSW 12 89510365 missense probably damaging 1.00
R2433:Nrxn3 UTSW 12 89976392 missense probably damaging 1.00
R2969:Nrxn3 UTSW 12 89354471 missense probably damaging 1.00
R3053:Nrxn3 UTSW 12 89255101 missense probably damaging 0.99
R3076:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R3078:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R4033:Nrxn3 UTSW 12 89533001 missense probably damaging 1.00
R4222:Nrxn3 UTSW 12 89532992 nonsense probably null
R4321:Nrxn3 UTSW 12 90199231 missense probably damaging 1.00
R4470:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4471:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4472:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4686:Nrxn3 UTSW 12 89510651 missense probably damaging 0.99
R4776:Nrxn3 UTSW 12 90331956 missense possibly damaging 0.55
R4821:Nrxn3 UTSW 12 90204709 missense probably damaging 0.99
R4910:Nrxn3 UTSW 12 89260360 missense possibly damaging 0.72
R4960:Nrxn3 UTSW 12 88795201 missense possibly damaging 0.79
R4990:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R4991:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R5057:Nrxn3 UTSW 12 89255034 missense probably damaging 0.99
R5329:Nrxn3 UTSW 12 89813584 missense possibly damaging 0.92
R5888:Nrxn3 UTSW 12 89512085 missense possibly damaging 0.91
R6249:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R6264:Nrxn3 UTSW 12 90332237 missense probably damaging 1.00
R6373:Nrxn3 UTSW 12 89976469 missense probably damaging 1.00
R6401:Nrxn3 UTSW 12 89255000 missense possibly damaging 0.46
R6434:Nrxn3 UTSW 12 88795515 missense probably benign 0.32
R6528:Nrxn3 UTSW 12 89513049 missense probably damaging 1.00
R6612:Nrxn3 UTSW 12 89813332 intron probably benign
R6632:Nrxn3 UTSW 12 89193154 missense probably damaging 1.00
R6874:Nrxn3 UTSW 12 90332190 missense probably damaging 0.99
R7122:Nrxn3 UTSW 12 89510607 missense probably damaging 1.00
R7328:Nrxn3 UTSW 12 88795575 missense probably benign
R7352:Nrxn3 UTSW 12 88850293 missense probably benign
R7425:Nrxn3 UTSW 12 89513100 nonsense probably null
R7444:Nrxn3 UTSW 12 89510694 missense probably damaging 1.00
R7483:Nrxn3 UTSW 12 89510462 missense probably damaging 1.00
R7599:Nrxn3 UTSW 12 89512062 missense probably benign
R7738:Nrxn3 UTSW 12 88850304 missense possibly damaging 0.68
R7765:Nrxn3 UTSW 12 89813484 missense probably benign 0.03
X0019:Nrxn3 UTSW 12 90199221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTTTCCACTGGGCTGCTC -3'
(R):5'- TTCTAACTGGACGCTCTGGC -3'

Sequencing Primer
(F):5'- CACTGGGCTGCTCCTGTATTTG -3'
(R):5'- CTCCCCAGAAGCCGAGGTTC -3'
Posted On2016-03-17