Incidental Mutation 'R4870:Mixl1'
ID376471
Institutional Source Beutler Lab
Gene Symbol Mixl1
Ensembl Gene ENSMUSG00000026497
Gene NameMix1 homeobox-like 1 (Xenopus laevis)
SynonymsMml
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180693043-180697034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180694672 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 215 (S215P)
Ref Sequence ENSEMBL: ENSMUSP00000027778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027778] [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]
Predicted Effect probably benign
Transcript: ENSMUST00000027778
AA Change: S215P

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027778
Gene: ENSMUSG00000026497
AA Change: S215P

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
HOX 86 148 1.58e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192561
SMART Domains Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 143 248 2.2e-71 SMART
coiled coil region 370 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192725
SMART Domains Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 103 208 2.2e-71 SMART
coiled coil region 330 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193892
SMART Domains Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.2e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194847
Meta Mutation Damage Score 0.0627 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeodomain proteins, such as MIXL1, are transcription factors that regulate cell fate during development (Hart et al., 2005 [PubMed 15982639]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null embryos are mostly arrested in development by E9 exhibiting abnormalities in primitive streak and node formation, disorganized head folds, foreshortened body axis, absence of heart tube and gut, deficient paraxial mesoderm, abnormal notochord morphology, and an enlarged allantois. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Mixl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02548:Mixl1 APN 1 180694704 missense probably benign 0.03
IGL03371:Mixl1 APN 1 180694626 missense probably benign 0.00
R0453:Mixl1 UTSW 1 180696646 missense probably damaging 1.00
R0838:Mixl1 UTSW 1 180696800 missense probably benign 0.45
R1832:Mixl1 UTSW 1 180694731 missense probably benign 0.11
R6046:Mixl1 UTSW 1 180696771 missense possibly damaging 0.94
R6918:Mixl1 UTSW 1 180694678 missense probably benign 0.02
R6980:Mixl1 UTSW 1 180696888 missense possibly damaging 0.51
R7047:Mixl1 UTSW 1 180696618 critical splice donor site probably null
R7296:Mixl1 UTSW 1 180696958 missense probably benign
X0065:Mixl1 UTSW 1 180694701 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTAAAGGCTCAGTGTC -3'
(R):5'- AGAGTGGGAAGTCATTTCAGCC -3'

Sequencing Primer
(F):5'- CTCAGTGTCAGAGAAGGGAACC -3'
(R):5'- AGTGGGAAGTCATTTCAGCCCTTATC -3'
Posted On2016-03-17