Incidental Mutation 'R4870:Mcm10'
ID376473
Institutional Source Beutler Lab
Gene Symbol Mcm10
Ensembl Gene ENSMUSG00000026669
Gene Nameminichromosome maintenance 10 replication initiation factor
SynonymsC330019M07Rik, 2410041F14Rik
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location4989714-5012791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5004159 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 333 (I333N)
Ref Sequence ENSEMBL: ENSMUSP00000100050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027980] [ENSMUST00000102985]
Predicted Effect probably damaging
Transcript: ENSMUST00000027980
AA Change: I333N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027980
Gene: ENSMUSG00000026669
AA Change: I333N

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 2e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102985
AA Change: I333N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100050
Gene: ENSMUSG00000026669
AA Change: I333N

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 3.7e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150091
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryonic cell proliferation and early embryonic letahlity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Mcm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Mcm10 APN 2 5008628 missense probably benign 0.00
IGL02028:Mcm10 APN 2 5008700 missense possibly damaging 0.95
IGL02672:Mcm10 APN 2 5001281 missense probably benign 0.00
IGL03352:Mcm10 APN 2 4994596 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0320:Mcm10 UTSW 2 5004086 missense probably benign
R0379:Mcm10 UTSW 2 5008623 missense probably benign 0.05
R0385:Mcm10 UTSW 2 5004154 missense possibly damaging 0.82
R0519:Mcm10 UTSW 2 5008545 missense probably benign
R1537:Mcm10 UTSW 2 4998780 missense possibly damaging 0.77
R1597:Mcm10 UTSW 2 4998752 missense probably damaging 1.00
R1727:Mcm10 UTSW 2 5006525 missense probably benign 0.10
R1758:Mcm10 UTSW 2 5004050 missense probably damaging 1.00
R1997:Mcm10 UTSW 2 4993760 missense probably damaging 1.00
R3618:Mcm10 UTSW 2 4997102 critical splice donor site probably null
R4005:Mcm10 UTSW 2 5001003 missense probably damaging 1.00
R5302:Mcm10 UTSW 2 5007370 missense probably benign 0.12
R5488:Mcm10 UTSW 2 4992118 missense probably damaging 1.00
R6921:Mcm10 UTSW 2 5000935 missense probably benign 0.00
R7259:Mcm10 UTSW 2 5006517 missense probably benign 0.02
R7353:Mcm10 UTSW 2 5007109 missense possibly damaging 0.54
R7489:Mcm10 UTSW 2 5001301 missense probably damaging 1.00
R7744:Mcm10 UTSW 2 4991442 missense probably damaging 1.00
R7903:Mcm10 UTSW 2 4995802 missense probably benign 0.00
X0020:Mcm10 UTSW 2 5007148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGTTCAAGCCTCACCTC -3'
(R):5'- ACTAAATTTCCCTGTGGCCTG -3'

Sequencing Primer
(F):5'- GAGTTCAAGCCTCACCTCTTTCAAG -3'
(R):5'- TCTGTTCATCTTACATGAGGCAG -3'
Posted On2016-03-17