Incidental Mutation 'R4870:Abcb11'
ID376474
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission 042480-MU
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69239196 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1285 (I1285N)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: I1285N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: I1285N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: I1285N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: I1285N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133663
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: I1285N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: I1285N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Meta Mutation Damage Score 0.1960 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7842:Abcb11 UTSW 2 69323873 small deletion probably benign
R7894:Abcb11 UTSW 2 69323873 small deletion probably benign
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7898:Abcb11 UTSW 2 69323873 small deletion probably benign
R7917:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCAGTGGATACTTCTGTCTG -3'
(R):5'- AGGTGGTATTTGCAATAGCCTCTC -3'

Sequencing Primer
(F):5'- ATTCTCTGTAGAGCTATGACAACCCG -3'
(R):5'- ATTTGCAATAGCCTCTCCCAGGG -3'
Posted On2016-03-17