Incidental Mutation 'R4870:Knl1'
ID376477
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119081513 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1704 (T1704A)
Ref Sequence ENSEMBL: ENSMUSP00000097140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028802] [ENSMUST00000099542]
Predicted Effect probably benign
Transcript: ENSMUST00000028802
AA Change: T1704A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: T1704A

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099542
AA Change: T1704A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: T1704A

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
R8423:Knl1 UTSW 2 119070032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCTCCCAGACATGGTGTC -3'
(R):5'- GTAGACAGAACTGGGTTTCTTTTC -3'

Sequencing Primer
(F):5'- TGTCACAGCGTGGCAAG -3'
(R):5'- CATTACAGATGGTTGTGAGCCACC -3'
Posted On2016-03-17