Mutagenetix > Incidental Mutations

Incidental Mutation 'R4870:Trp53bp1'

376478

Institutional Source

Beutler Lab

Gene Symbol

Trp53bp1

Ensembl Gene

ENSMUSG00000043909

Gene Name

transformation related protein 53 binding protein 1

Synonyms

53BP1, p53BP1

MMRRC Submission

042480-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121193281-121271407 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121256641 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 178 (L178P)

Ref Sequence

ENSEMBL: ENSMUSP00000114457 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000129752] [ENSMUST00000131245]

Predicted Effect

probably damaging
Transcript: ENSMUST00000110647
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: L178P

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1430	1551	2.5e-80	PFAM
low complexity region	1581	1601	N/A	INTRINSIC
BRCT	1673	1785	7.13e-1	SMART
BRCT	1813	1901	1.03e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110648
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: L178P

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1480	1601	1.5e-80	PFAM
low complexity region	1631	1651	N/A	INTRINSIC
BRCT	1723	1835	7.13e-1	SMART
BRCT	1863	1951	1.03e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129752

Predicted Effect

probably damaging
Transcript: ENSMUST00000131245
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: L178P

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131426

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136617

Meta Mutation Damage Score

0.3888

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

100% (77/77)

MGI Phenotype

PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	C	A	7: 34,284,887	V104L	possibly damaging	Het
Abcb11	A	T	2: 69,239,196	I1285N	probably damaging	Het
Abcc8	G	A	7: 46,107,259	R721*	probably null	Het
Alox8	T	C	11: 69,186,568	Y423C	probably damaging	Het
Ankle2	T	A	5: 110,251,478		probably null	Het
Cdc14a	A	G	3: 116,423,460	I9T	probably benign	Het
Ceacam18	T	C	7: 43,641,904	C257R	probably damaging	Het
Cilp	T	C	9: 65,279,698	V1025A	probably damaging	Het
Clcn7	G	T	17: 25,153,565		probably benign	Het
Csnk1d	A	T	11: 120,983,188		probably benign	Het
Cyp11b2	A	G	15: 74,853,146	S285P	probably benign	Het
Dip2b	T	A	15: 100,195,784		probably null	Het
Dmrt1	T	A	19: 25,505,855	M1K	probably null	Het
Dnajc14	T	C	10: 128,817,350	V684A	probably benign	Het
Dnmt3b	A	G	2: 153,670,364	Q335R	probably benign	Het
Exoc3l2	T	A	7: 19,495,192	C772S	unknown	Het
F2rl1	A	T	13: 95,513,984	F130Y	probably damaging	Het
Galk2	C	G	2: 125,929,637	S194*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpbp1l1	A	G	4: 116,573,517	T62A	probably benign	Het
H2-Q10	A	T	17: 35,470,460	D53V	probably damaging	Het
H2-T22	T	C	17: 36,039,032	K356R	probably benign	Het
Insrr	G	A	3: 87,811,604	V956M	probably damaging	Het
Ints7	A	G	1: 191,596,331	T239A	probably damaging	Het
Isl1	A	G	13: 116,308,270		probably benign	Het
Kcng2	A	G	18: 80,322,868	C90R	probably benign	Het
Kif3c	C	T	12: 3,401,735	P171S	probably damaging	Het
Knl1	A	G	2: 119,081,513	T1704A	probably benign	Het
Lats1	A	G	10: 7,705,785	Y778C	probably damaging	Het
Limd2	T	C	11: 106,159,389	M1V	probably null	Het
Mcm10	A	T	2: 5,004,159	I333N	probably damaging	Het
Mipep	T	A	14: 60,802,880	L283*	probably null	Het
Mixl1	A	G	1: 180,694,672	S215P	probably benign	Het
Mmp21	A	G	7: 133,678,677	L188P	probably damaging	Het
Mob1a	T	C	6: 83,340,239	S213P	probably benign	Het
Ndufaf6	T	C	4: 11,060,917	T220A	probably benign	Het
Nr4a3	A	T	4: 48,051,651	Y135F	possibly damaging	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Obscn	A	T	11: 59,136,206	L57Q	probably damaging	Het
Olfr1161	T	C	2: 88,025,460	L246P	probably damaging	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pirb	T	A	7: 3,712,662	M839L	probably benign	Het
Plcl2	A	G	17: 50,607,226	E421G	possibly damaging	Het
Ppp1r12b	T	C	1: 134,949,033	N99S	probably benign	Het
Ptpro	A	G	6: 137,377,132	K169E	probably damaging	Het
Rita1	T	A	5: 120,611,383	K88N	probably damaging	Het
Rptn	A	T	3: 93,396,469	K370*	probably null	Het
Simc1	A	G	13: 54,539,763	D115G	probably null	Het
Stab1	T	A	14: 31,142,043	N136I	probably benign	Het
Syt4	T	A	18: 31,447,356		probably benign	Het
Sytl2	A	T	7: 90,388,898	N522I	probably damaging	Het
Tax1bp1	A	G	6: 52,729,493		probably benign	Het
Tenm2	A	T	11: 36,078,569	D847E	probably damaging	Het
Th	G	T	7: 142,894,097	D321E	probably benign	Het
Tmem44	A	T	16: 30,540,773	L46Q	probably damaging	Het
Trp63	A	G	16: 25,866,218	*285W	probably null	Het
Tsen34	T	C	7: 3,694,381		probably benign	Het
Tssk4	C	T	14: 55,651,815	T256I	probably benign	Het
Ttc17	A	T	2: 94,366,609	N464K	probably damaging	Het
Ttll2	C	T	17: 7,351,599	V310I	probably benign	Het
Ubn1	A	G	16: 5,077,313	E741G	probably damaging	Het
Urad	T	A	5: 147,315,454	I63F	probably damaging	Het
Vcan	T	C	13: 89,704,739	T701A	probably benign	Het
Vmn2r58	A	G	7: 41,837,215	V752A	possibly damaging	Het
Vmn2r69	C	A	7: 85,411,585	V264L	possibly damaging	Het
Zfp292	A	G	4: 34,808,917	S1376P	probably damaging	Het
Zfp955a	G	A	17: 33,241,725	R478*	probably null	Het
Znfx1	A	C	2: 167,055,269	F578L	probably benign	Het

Other mutations in Trp53bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Trp53bp1	APN	2	121256579	missense	possibly damaging	0.69
IGL00690:Trp53bp1	APN	2	121235995	missense	probably damaging	1.00
IGL00922:Trp53bp1	APN	2	121208482	missense	probably damaging	0.96
IGL01475:Trp53bp1	APN	2	121270319	splice site	probably null
IGL01639:Trp53bp1	APN	2	121202692	missense	possibly damaging	0.51
IGL01662:Trp53bp1	APN	2	121236025	missense	probably damaging	1.00
IGL01757:Trp53bp1	APN	2	121211304	missense	probably damaging	0.99
IGL01829:Trp53bp1	APN	2	121215896	missense	probably benign	0.39
IGL02247:Trp53bp1	APN	2	121236589	missense	probably damaging	1.00
IGL02349:Trp53bp1	APN	2	121199074	missense	probably damaging	1.00
IGL02391:Trp53bp1	APN	2	121202710	missense	possibly damaging	0.67
chives	UTSW	2	121251868	missense	probably null	0.13
concur	UTSW	2	121270319	splice site	probably null
confirmation	UTSW	2	121205113	critical splice acceptor site	probably null
Infra	UTSW	2	121247499	critical splice donor site	probably null
Legume	UTSW	2	121199042	missense	probably damaging	0.99
lentil	UTSW	2	121251868	missense	probably null	0.13
lentil2	UTSW	2	121207887	missense	probably damaging	1.00
Profundus	UTSW	2	121207803	missense	probably damaging	1.00
split_pea	UTSW	2	121228606	nonsense	probably null
verily	UTSW	2	121211313	missense	probably damaging	1.00
PIT1430001:Trp53bp1	UTSW	2	121271275	missense	probably damaging	1.00
R0045:Trp53bp1	UTSW	2	121204497	missense	probably benign
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0281:Trp53bp1	UTSW	2	121270237	missense	probably damaging	1.00
R0386:Trp53bp1	UTSW	2	121204943	missense	probably damaging	1.00
R0427:Trp53bp1	UTSW	2	121236017	missense	probably damaging	1.00
R0505:Trp53bp1	UTSW	2	121269969	missense	probably damaging	0.99
R0522:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0523:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0525:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0543:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0559:Trp53bp1	UTSW	2	121227801	missense	probably damaging	1.00
R0573:Trp53bp1	UTSW	2	121228172	splice site	probably benign
R0593:Trp53bp1	UTSW	2	121270528	missense	possibly damaging	0.95
R0648:Trp53bp1	UTSW	2	121235707	missense	probably benign	0.20
R0680:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0732:Trp53bp1	UTSW	2	121248264	missense	probably null	0.96
R0905:Trp53bp1	UTSW	2	121204318	splice site	probably benign
R1377:Trp53bp1	UTSW	2	121270642	missense	probably damaging	1.00
R1415:Trp53bp1	UTSW	2	121236184	missense	probably damaging	1.00
R1725:Trp53bp1	UTSW	2	121252000	missense	possibly damaging	0.46
R1971:Trp53bp1	UTSW	2	121205036	missense	probably damaging	1.00
R2045:Trp53bp1	UTSW	2	121204483	missense	probably benign
R2143:Trp53bp1	UTSW	2	121216064	missense	probably benign	0.00
R2282:Trp53bp1	UTSW	2	121270273	nonsense	probably null
R2296:Trp53bp1	UTSW	2	121209247	missense	possibly damaging	0.96
R3106:Trp53bp1	UTSW	2	121236652	missense	probably damaging	1.00
R3792:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3793:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3946:Trp53bp1	UTSW	2	121228626	missense	probably damaging	0.99
R4001:Trp53bp1	UTSW	2	121205085	missense	probably damaging	1.00
R4327:Trp53bp1	UTSW	2	121256650	missense	probably damaging	1.00
R4585:Trp53bp1	UTSW	2	121207951	missense	probably damaging	1.00
R4630:Trp53bp1	UTSW	2	121207887	missense	probably damaging	1.00
R4744:Trp53bp1	UTSW	2	121211313	missense	probably damaging	1.00
R4751:Trp53bp1	UTSW	2	121227809	missense	probably damaging	1.00
R4754:Trp53bp1	UTSW	2	121207879	missense	probably damaging	1.00
R4755:Trp53bp1	UTSW	2	121228606	nonsense	probably null
R4850:Trp53bp1	UTSW	2	121205113	critical splice acceptor site	probably null
R4879:Trp53bp1	UTSW	2	121202603	missense	probably damaging	0.99
R4924:Trp53bp1	UTSW	2	121221220	nonsense	probably null
R4962:Trp53bp1	UTSW	2	121270546	missense	probably benign	0.12
R5019:Trp53bp1	UTSW	2	121270319	splice site	probably null
R5111:Trp53bp1	UTSW	2	121211387	missense	probably damaging	0.99
R5149:Trp53bp1	UTSW	2	121216117	missense	probably benign	0.00
R5252:Trp53bp1	UTSW	2	121243983	missense	probably benign	0.40
R5533:Trp53bp1	UTSW	2	121207746	missense	probably damaging	1.00
R5642:Trp53bp1	UTSW	2	121236662	missense	probably benign	0.00
R5773:Trp53bp1	UTSW	2	121243914	missense	probably damaging	1.00
R5819:Trp53bp1	UTSW	2	121208392	nonsense	probably null
R5886:Trp53bp1	UTSW	2	121205021	missense	probably damaging	1.00
R5908:Trp53bp1	UTSW	2	121236823	missense	probably benign	0.06
R6012:Trp53bp1	UTSW	2	121256602	missense	probably benign	0.07
R6351:Trp53bp1	UTSW	2	121269945	missense	probably damaging	1.00
R6406:Trp53bp1	UTSW	2	121270612	missense	probably damaging	0.99
R6575:Trp53bp1	UTSW	2	121228603	missense	probably damaging	1.00
R6619:Trp53bp1	UTSW	2	121247499	critical splice donor site	probably null
R6626:Trp53bp1	UTSW	2	121207803	missense	probably damaging	1.00
R6754:Trp53bp1	UTSW	2	121270576	missense	possibly damaging	0.83
R6765:Trp53bp1	UTSW	2	121209309	missense	probably damaging	1.00
R6806:Trp53bp1	UTSW	2	121228666	missense	probably damaging	0.99
R6860:Trp53bp1	UTSW	2	121199113	missense	probably damaging	1.00
R6991:Trp53bp1	UTSW	2	121208040	missense	probably damaging	1.00
R7278:Trp53bp1	UTSW	2	121199035	missense	probably damaging	1.00
R7339:Trp53bp1	UTSW	2	121236469	missense	probably benign	0.00
R7357:Trp53bp1	UTSW	2	121211300	missense	probably damaging	1.00
R7477:Trp53bp1	UTSW	2	121236346	missense	probably benign	0.34
R7577:Trp53bp1	UTSW	2	121236638	missense	possibly damaging	0.65
R7643:Trp53bp1	UTSW	2	121247814	splice site	probably null
R7728:Trp53bp1	UTSW	2	121207899	missense	probably damaging	1.00
R7806:Trp53bp1	UTSW	2	121205061	missense	probably damaging	0.99
R7955:Trp53bp1	UTSW	2	121235744	missense	possibly damaging	0.59
R8099:Trp53bp1	UTSW	2	121199749	missense	probably damaging	1.00
R8200:Trp53bp1	UTSW	2	121236176	missense	probably benign	0.00
R8282:Trp53bp1	UTSW	2	121199042	missense	probably damaging	0.99
RF046:Trp53bp1	UTSW	2	121216001	frame shift	probably null
Z1088:Trp53bp1	UTSW	2	121253645	missense	probably benign	0.04
Z1177:Trp53bp1	UTSW	2	121244060	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- CTTGTCCTAAGGGAGAGAAAACAAC -3'
(R):5'- TGTGTGCCAAAGCTTTGATATGAAG -3'

Sequencing Primer
(F):5'- CTTATAACCAGCTCCACATGTGAG -3'
(R):5'- GAGTATTTGCCAGCTAAGCTAAGCC -3'

Posted On

2016-03-17