Incidental Mutation 'R4870:Dnmt3b'
ID376480
Institutional Source Beutler Lab
Gene Symbol Dnmt3b
Ensembl Gene ENSMUSG00000027478
Gene NameDNA methyltransferase 3B
Synonyms
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153649450-153687730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153670364 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 335 (Q335R)
Ref Sequence ENSEMBL: ENSMUSP00000105393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056495] [ENSMUST00000072997] [ENSMUST00000081628] [ENSMUST00000088976] [ENSMUST00000103150] [ENSMUST00000103151] [ENSMUST00000109771] [ENSMUST00000109772] [ENSMUST00000109773] [ENSMUST00000109774]
Predicted Effect probably benign
Transcript: ENSMUST00000056495
AA Change: Q335R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000051830
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072997
AA Change: Q335R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072761
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081628
AA Change: Q335R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080334
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088976
AA Change: Q335R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086370
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103150
AA Change: Q335R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099439
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103151
AA Change: Q335R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099440
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 8e-55 PDB
Blast:RING 463 512 6e-28 BLAST
Pfam:DNA_methylase 561 707 4.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109771
AA Change: Q335R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105393
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 582 732 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109772
AA Change: Q335R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105394
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 7e-55 PDB
Blast:RING 483 532 5e-28 BLAST
Pfam:DNA_methylase 581 727 2.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109773
AA Change: Q335R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105395
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
PDB:3A1A|A 401 540 1e-54 PDB
Blast:RING 463 512 7e-28 BLAST
Pfam:DNA_methylase 561 711 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109774
AA Change: Q335R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105396
Gene: ENSMUSG00000027478
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 57 74 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
low complexity region 157 179 N/A INTRINSIC
PWWP 230 288 2.43e-26 SMART
low complexity region 380 389 N/A INTRINSIC
PDB:3A1A|A 421 560 8e-55 PDB
Blast:RING 483 532 6e-28 BLAST
Pfam:DNA_methylase 581 731 4.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140811
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene results in severe developmental defects and loss of viability. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies (ICF) syndrome. There is a pseudogene for this gene located adjacent to this gene in the same region of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation and rostral neural tube defects, and die prenatally. Mutants exhibit slight under-methylation of endogenous viral DNA and substantial demethylation of minor satellite DNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Dnmt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Dnmt3b APN 2 153672502 missense possibly damaging 0.88
IGL00931:Dnmt3b APN 2 153686250 splice site probably benign
IGL01073:Dnmt3b APN 2 153670842 splice site probably benign
IGL01138:Dnmt3b APN 2 153661441 missense probably benign 0.01
IGL01960:Dnmt3b APN 2 153676711 missense possibly damaging 0.83
IGL02884:Dnmt3b APN 2 153674377 missense probably damaging 1.00
IGL03382:Dnmt3b APN 2 153686359 missense probably damaging 1.00
PIT4151001:Dnmt3b UTSW 2 153684479 critical splice donor site probably null
R0062:Dnmt3b UTSW 2 153672272 missense probably benign 0.01
R0122:Dnmt3b UTSW 2 153676698 missense probably damaging 1.00
R0147:Dnmt3b UTSW 2 153661457 missense possibly damaging 0.68
R0178:Dnmt3b UTSW 2 153675018 missense probably benign 0.41
R0751:Dnmt3b UTSW 2 153674842 splice site probably null
R1696:Dnmt3b UTSW 2 153676710 nonsense probably null
R1795:Dnmt3b UTSW 2 153683639 missense possibly damaging 0.92
R1889:Dnmt3b UTSW 2 153676759 missense probably benign
R2898:Dnmt3b UTSW 2 153667630 missense possibly damaging 0.85
R4201:Dnmt3b UTSW 2 153670417 nonsense probably null
R4630:Dnmt3b UTSW 2 153670315 nonsense probably null
R5648:Dnmt3b UTSW 2 153677198 missense probably damaging 1.00
R5814:Dnmt3b UTSW 2 153672497 missense probably benign 0.00
R6311:Dnmt3b UTSW 2 153674005 missense probably damaging 1.00
R6625:Dnmt3b UTSW 2 153665313 missense probably benign
R6818:Dnmt3b UTSW 2 153686284 missense probably damaging 1.00
R7258:Dnmt3b UTSW 2 153683599 splice site probably null
R7473:Dnmt3b UTSW 2 153684450 missense probably damaging 1.00
R7570:Dnmt3b UTSW 2 153676699 missense probably damaging 1.00
R7627:Dnmt3b UTSW 2 153677580 missense probably benign 0.03
R7709:Dnmt3b UTSW 2 153672220 missense probably benign 0.10
R8483:Dnmt3b UTSW 2 153674386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTAGGGAAATGCAGGCCC -3'
(R):5'- TTTTAACAGCCCTGGGTTCCAC -3'

Sequencing Primer
(F):5'- GAAATGCAGGCCCCCAGC -3'
(R):5'- GGCACAATAGGCCTTGCTTG -3'
Posted On2016-03-17