Mutagenetix > Incidental Mutations

Incidental Mutation 'R4870:Rptn'

376483

Institutional Source

Beutler Lab

Gene Symbol

Rptn

Ensembl Gene

ENSMUSG00000041984

Gene Name

repetin

Synonyms

MMRRC Submission

042480-MU

Accession Numbers

Genbank: NM_009100; MGI: 1099055

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R4870 (G1)

Quality Score

167

Status

Validated

Chromosome

Chromosomal Location

93393699-93399442 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 93396469 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 370 (K370*)

Ref Sequence

ENSEMBL: ENSMUSP00000044998 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045912]

Predicted Effect

probably null
Transcript: ENSMUST00000045912
AA Change: K370*

SMART Domains

Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: K370*

Domain	Start	End	E-Value	Type
Pfam:S_100	4	46	3.2e-13	PFAM
Blast:EFh	53	81	5e-10	BLAST
low complexity region	189	204	N/A	INTRINSIC
low complexity region	237	252	N/A	INTRINSIC
Blast:CTD	318	461	1e-7	BLAST
low complexity region	1007	1041	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191784

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195137

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

100% (77/77)

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	C	A	7: 34,284,887	V104L	possibly damaging	Het
Abcb11	A	T	2: 69,239,196	I1285N	probably damaging	Het
Abcc8	G	A	7: 46,107,259	R721*	probably null	Het
Alox8	T	C	11: 69,186,568	Y423C	probably damaging	Het
Ankle2	T	A	5: 110,251,478		probably null	Het
Cdc14a	A	G	3: 116,423,460	I9T	probably benign	Het
Ceacam18	T	C	7: 43,641,904	C257R	probably damaging	Het
Cilp	T	C	9: 65,279,698	V1025A	probably damaging	Het
Clcn7	G	T	17: 25,153,565		probably benign	Het
Csnk1d	A	T	11: 120,983,188		probably benign	Het
Cyp11b2	A	G	15: 74,853,146	S285P	probably benign	Het
Dip2b	T	A	15: 100,195,784		probably null	Het
Dmrt1	T	A	19: 25,505,855	M1K	probably null	Het
Dnajc14	T	C	10: 128,817,350	V684A	probably benign	Het
Dnmt3b	A	G	2: 153,670,364	Q335R	probably benign	Het
Exoc3l2	T	A	7: 19,495,192	C772S	unknown	Het
F2rl1	A	T	13: 95,513,984	F130Y	probably damaging	Het
Galk2	C	G	2: 125,929,637	S194*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpbp1l1	A	G	4: 116,573,517	T62A	probably benign	Het
H2-Q10	A	T	17: 35,470,460	D53V	probably damaging	Het
H2-T22	T	C	17: 36,039,032	K356R	probably benign	Het
Insrr	G	A	3: 87,811,604	V956M	probably damaging	Het
Ints7	A	G	1: 191,596,331	T239A	probably damaging	Het
Isl1	A	G	13: 116,308,270		probably benign	Het
Kcng2	A	G	18: 80,322,868	C90R	probably benign	Het
Kif3c	C	T	12: 3,401,735	P171S	probably damaging	Het
Knl1	A	G	2: 119,081,513	T1704A	probably benign	Het
Lats1	A	G	10: 7,705,785	Y778C	probably damaging	Het
Limd2	T	C	11: 106,159,389	M1V	probably null	Het
Mcm10	A	T	2: 5,004,159	I333N	probably damaging	Het
Mipep	T	A	14: 60,802,880	L283*	probably null	Het
Mixl1	A	G	1: 180,694,672	S215P	probably benign	Het
Mmp21	A	G	7: 133,678,677	L188P	probably damaging	Het
Mob1a	T	C	6: 83,340,239	S213P	probably benign	Het
Ndufaf6	T	C	4: 11,060,917	T220A	probably benign	Het
Nr4a3	A	T	4: 48,051,651	Y135F	possibly damaging	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Obscn	A	T	11: 59,136,206	L57Q	probably damaging	Het
Olfr1161	T	C	2: 88,025,460	L246P	probably damaging	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pirb	T	A	7: 3,712,662	M839L	probably benign	Het
Plcl2	A	G	17: 50,607,226	E421G	possibly damaging	Het
Ppp1r12b	T	C	1: 134,949,033	N99S	probably benign	Het
Ptpro	A	G	6: 137,377,132	K169E	probably damaging	Het
Rita1	T	A	5: 120,611,383	K88N	probably damaging	Het
Simc1	A	G	13: 54,539,763	D115G	probably null	Het
Stab1	T	A	14: 31,142,043	N136I	probably benign	Het
Syt4	T	A	18: 31,447,356		probably benign	Het
Sytl2	A	T	7: 90,388,898	N522I	probably damaging	Het
Tax1bp1	A	G	6: 52,729,493		probably benign	Het
Tenm2	A	T	11: 36,078,569	D847E	probably damaging	Het
Th	G	T	7: 142,894,097	D321E	probably benign	Het
Tmem44	A	T	16: 30,540,773	L46Q	probably damaging	Het
Trp53bp1	A	G	2: 121,256,641	L178P	probably damaging	Het
Trp63	A	G	16: 25,866,218	*285W	probably null	Het
Tsen34	T	C	7: 3,694,381		probably benign	Het
Tssk4	C	T	14: 55,651,815	T256I	probably benign	Het
Ttc17	A	T	2: 94,366,609	N464K	probably damaging	Het
Ttll2	C	T	17: 7,351,599	V310I	probably benign	Het
Ubn1	A	G	16: 5,077,313	E741G	probably damaging	Het
Urad	T	A	5: 147,315,454	I63F	probably damaging	Het
Vcan	T	C	13: 89,704,739	T701A	probably benign	Het
Vmn2r58	A	G	7: 41,837,215	V752A	possibly damaging	Het
Vmn2r69	C	A	7: 85,411,585	V264L	possibly damaging	Het
Zfp292	A	G	4: 34,808,917	S1376P	probably damaging	Het
Zfp955a	G	A	17: 33,241,725	R478*	probably null	Het
Znfx1	A	C	2: 167,055,269	F578L	probably benign	Het

Other mutations in Rptn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Rptn	APN	3	93397182	missense	probably benign
IGL01070:Rptn	APN	3	93398176	missense	possibly damaging	0.86
IGL01625:Rptn	APN	3	93397894	missense	probably benign	0.18
IGL01678:Rptn	APN	3	93396811	missense	probably benign	0.00
IGL01716:Rptn	APN	3	93396710	missense	possibly damaging	0.53
IGL01767:Rptn	APN	3	93395639	missense	probably benign	0.00
IGL01872:Rptn	APN	3	93396847	missense	probably benign
IGL02000:Rptn	APN	3	93396428	missense	probably benign	0.01
IGL02066:Rptn	APN	3	93397129	missense	probably benign	0.01
IGL02090:Rptn	APN	3	93396734	missense	possibly damaging	0.85
IGL02116:Rptn	APN	3	93395097	missense	possibly damaging	0.88
IGL02216:Rptn	APN	3	93395773	missense	possibly damaging	0.73
IGL02368:Rptn	APN	3	93397171	missense	probably benign	0.18
IGL02820:Rptn	APN	3	93396920	missense	probably benign	0.01
IGL03323:Rptn	APN	3	93397153	missense	probably benign
IGL03404:Rptn	APN	3	93398129	missense	possibly damaging	0.53
D3080:Rptn	UTSW	3	93395828	missense	possibly damaging	0.85
H8786:Rptn	UTSW	3	93397873	missense	possibly damaging	0.53
IGL03097:Rptn	UTSW	3	93397373	missense	probably damaging	1.00
LCD18:Rptn	UTSW	3	93397541	missense	probably benign
PIT4431001:Rptn	UTSW	3	93397397	small deletion	probably benign
PIT4480001:Rptn	UTSW	3	93397670	missense	possibly damaging	0.85
R1024:Rptn	UTSW	3	93398225	missense	possibly damaging	0.72
R1119:Rptn	UTSW	3	93396245	missense	possibly damaging	0.96
R1727:Rptn	UTSW	3	93397138	missense	possibly damaging	0.73
R1901:Rptn	UTSW	3	93396710	missense	possibly damaging	0.53
R2247:Rptn	UTSW	3	93396829	missense	probably benign
R2921:Rptn	UTSW	3	93398708	missense	possibly damaging	0.96
R2922:Rptn	UTSW	3	93398708	missense	possibly damaging	0.96
R2923:Rptn	UTSW	3	93398708	missense	possibly damaging	0.96
R3901:Rptn	UTSW	3	93398357	missense	probably benign
R3936:Rptn	UTSW	3	93395576	missense	possibly damaging	0.79
R4304:Rptn	UTSW	3	93396931	missense	probably benign	0.33
R4491:Rptn	UTSW	3	93396511	nonsense	probably null
R4654:Rptn	UTSW	3	93397485	missense	possibly damaging	0.53
R5246:Rptn	UTSW	3	93396833	missense	probably damaging	0.98
R5246:Rptn	UTSW	3	93397729	missense	possibly damaging	0.53
R5544:Rptn	UTSW	3	93398473	missense	possibly damaging	0.53
R5555:Rptn	UTSW	3	93396701	missense	probably benign
R5896:Rptn	UTSW	3	93398332	nonsense	probably null
R5956:Rptn	UTSW	3	93398027	missense	possibly damaging	0.53
R6192:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6209:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6224:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6226:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6227:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6230:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6247:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6258:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6393:Rptn	UTSW	3	93397199	missense	probably benign
R6513:Rptn	UTSW	3	93396112	missense	possibly damaging	0.73
R6854:Rptn	UTSW	3	93398123	missense	possibly damaging	0.53
R6855:Rptn	UTSW	3	93398251	missense	probably benign	0.33
R6884:Rptn	UTSW	3	93395789	missense	probably benign	0.33
R7018:Rptn	UTSW	3	93397900	missense	possibly damaging	0.73
R7241:Rptn	UTSW	3	93395954	missense	probably benign	0.01
R7337:Rptn	UTSW	3	93396905	missense	probably benign	0.03
R7754:Rptn	UTSW	3	93395921	missense	probably damaging	0.98
R7794:Rptn	UTSW	3	93395729	missense	probably benign
R7801:Rptn	UTSW	3	93398224	missense	possibly damaging	0.53
R8161:Rptn	UTSW	3	93396693	small deletion	probably benign
R8374:Rptn	UTSW	3	93396295	nonsense	probably null
X0018:Rptn	UTSW	3	93395941	nonsense	probably null
Z1088:Rptn	UTSW	3	93397427	missense	probably benign	0.01
Z1176:Rptn	UTSW	3	93395018	missense	probably benign	0.26
Z1177:Rptn	UTSW	3	93395643	nonsense	probably null
Z1177:Rptn	UTSW	3	93395712	missense	probably benign	0.01
Z1177:Rptn	UTSW	3	93397887	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TTCATACCATGAGCAGACAGAGG -3'
(R):5'- GAGAACTCTGGTCTTGCCTG -3'

Sequencing Primer
(F):5'- GGACAAGGTCAGAGTTTCCATTATG -3'
(R):5'- GCCTTTCTGACCCTGGTGG -3'

Posted On

2016-03-17