Mutagenetix > Incidental Mutations

Incidental Mutation 'R4870:Nr4a3'

376488

Institutional Source

Beutler Lab

Gene Symbol

Nr4a3

Ensembl Gene

ENSMUSG00000028341

Gene Name

nuclear receptor subfamily 4, group A, member 3

Synonyms

Nor1, TEC, MINOR, NOR-1

MMRRC Submission

042480-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48045153-48086447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 48051651 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 135 (Y135F)

Ref Sequence

ENSEMBL: ENSMUSP00000030025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030025]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030025
AA Change: Y135F

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: Y135F

Domain	Start	End	E-Value	Type
Blast:HOLI	1	43	4e-18	BLAST
low complexity region	99	115	N/A	INTRINSIC
low complexity region	139	151	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
low complexity region	218	239	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
ZnF_C4	290	361	4.57e-39	SMART
low complexity region	376	396	N/A	INTRINSIC
HOLI	440	595	2.46e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133539

Predicted Effect

unknown
Transcript: ENSMUST00000153369
AA Change: Y164F

SMART Domains

Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: Y164F

Domain	Start	End	E-Value	Type
Blast:HOLI	30	73	8e-19	BLAST
low complexity region	129	145	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC
low complexity region	226	240	N/A	INTRINSIC
low complexity region	248	269	N/A	INTRINSIC
low complexity region	299	318	N/A	INTRINSIC
ZnF_C4	320	391	4.57e-39	SMART
low complexity region	406	426	N/A	INTRINSIC
HOLI	470	625	2.46e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154186

Meta Mutation Damage Score

0.0973

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	C	A	7: 34,284,887	V104L	possibly damaging	Het
Abcb11	A	T	2: 69,239,196	I1285N	probably damaging	Het
Abcc8	G	A	7: 46,107,259	R721*	probably null	Het
Alox8	T	C	11: 69,186,568	Y423C	probably damaging	Het
Ankle2	T	A	5: 110,251,478		probably null	Het
Cdc14a	A	G	3: 116,423,460	I9T	probably benign	Het
Ceacam18	T	C	7: 43,641,904	C257R	probably damaging	Het
Cilp	T	C	9: 65,279,698	V1025A	probably damaging	Het
Clcn7	G	T	17: 25,153,565		probably benign	Het
Csnk1d	A	T	11: 120,983,188		probably benign	Het
Cyp11b2	A	G	15: 74,853,146	S285P	probably benign	Het
Dip2b	T	A	15: 100,195,784		probably null	Het
Dmrt1	T	A	19: 25,505,855	M1K	probably null	Het
Dnajc14	T	C	10: 128,817,350	V684A	probably benign	Het
Dnmt3b	A	G	2: 153,670,364	Q335R	probably benign	Het
Exoc3l2	T	A	7: 19,495,192	C772S	unknown	Het
F2rl1	A	T	13: 95,513,984	F130Y	probably damaging	Het
Galk2	C	G	2: 125,929,637	S194*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpbp1l1	A	G	4: 116,573,517	T62A	probably benign	Het
H2-Q10	A	T	17: 35,470,460	D53V	probably damaging	Het
H2-T22	T	C	17: 36,039,032	K356R	probably benign	Het
Insrr	G	A	3: 87,811,604	V956M	probably damaging	Het
Ints7	A	G	1: 191,596,331	T239A	probably damaging	Het
Isl1	A	G	13: 116,308,270		probably benign	Het
Kcng2	A	G	18: 80,322,868	C90R	probably benign	Het
Kif3c	C	T	12: 3,401,735	P171S	probably damaging	Het
Knl1	A	G	2: 119,081,513	T1704A	probably benign	Het
Lats1	A	G	10: 7,705,785	Y778C	probably damaging	Het
Limd2	T	C	11: 106,159,389	M1V	probably null	Het
Mcm10	A	T	2: 5,004,159	I333N	probably damaging	Het
Mipep	T	A	14: 60,802,880	L283*	probably null	Het
Mixl1	A	G	1: 180,694,672	S215P	probably benign	Het
Mmp21	A	G	7: 133,678,677	L188P	probably damaging	Het
Mob1a	T	C	6: 83,340,239	S213P	probably benign	Het
Ndufaf6	T	C	4: 11,060,917	T220A	probably benign	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Obscn	A	T	11: 59,136,206	L57Q	probably damaging	Het
Olfr1161	T	C	2: 88,025,460	L246P	probably damaging	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pirb	T	A	7: 3,712,662	M839L	probably benign	Het
Plcl2	A	G	17: 50,607,226	E421G	possibly damaging	Het
Ppp1r12b	T	C	1: 134,949,033	N99S	probably benign	Het
Ptpro	A	G	6: 137,377,132	K169E	probably damaging	Het
Rita1	T	A	5: 120,611,383	K88N	probably damaging	Het
Rptn	A	T	3: 93,396,469	K370*	probably null	Het
Simc1	A	G	13: 54,539,763	D115G	probably null	Het
Stab1	T	A	14: 31,142,043	N136I	probably benign	Het
Syt4	T	A	18: 31,447,356		probably benign	Het
Sytl2	A	T	7: 90,388,898	N522I	probably damaging	Het
Tax1bp1	A	G	6: 52,729,493		probably benign	Het
Tenm2	A	T	11: 36,078,569	D847E	probably damaging	Het
Th	G	T	7: 142,894,097	D321E	probably benign	Het
Tmem44	A	T	16: 30,540,773	L46Q	probably damaging	Het
Trp53bp1	A	G	2: 121,256,641	L178P	probably damaging	Het
Trp63	A	G	16: 25,866,218	*285W	probably null	Het
Tsen34	T	C	7: 3,694,381		probably benign	Het
Tssk4	C	T	14: 55,651,815	T256I	probably benign	Het
Ttc17	A	T	2: 94,366,609	N464K	probably damaging	Het
Ttll2	C	T	17: 7,351,599	V310I	probably benign	Het
Ubn1	A	G	16: 5,077,313	E741G	probably damaging	Het
Urad	T	A	5: 147,315,454	I63F	probably damaging	Het
Vcan	T	C	13: 89,704,739	T701A	probably benign	Het
Vmn2r58	A	G	7: 41,837,215	V752A	possibly damaging	Het
Vmn2r69	C	A	7: 85,411,585	V264L	possibly damaging	Het
Zfp292	A	G	4: 34,808,917	S1376P	probably damaging	Het
Zfp955a	G	A	17: 33,241,725	R478*	probably null	Het
Znfx1	A	C	2: 167,055,269	F578L	probably benign	Het

Other mutations in Nr4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Nr4a3	APN	4	48051586	missense	possibly damaging	0.48
IGL01407:Nr4a3	APN	4	48083201	missense	probably benign	0.00
IGL01454:Nr4a3	APN	4	48067803	missense	probably damaging	1.00
IGL01472:Nr4a3	APN	4	48071133	missense	probably damaging	1.00
IGL02622:Nr4a3	APN	4	48051649	missense	probably benign	0.06
IGL03401:Nr4a3	APN	4	48070987	splice site	probably null
bulbous	UTSW	4	48083255	missense	probably damaging	0.98
cronus	UTSW	4	48056539	missense	probably damaging	1.00
I1329:Nr4a3	UTSW	4	48051585	missense	probably benign	0.12
R0486:Nr4a3	UTSW	4	48056525	splice site	probably benign
R0610:Nr4a3	UTSW	4	48051903	missense	probably benign	0.10
R1170:Nr4a3	UTSW	4	48051564	missense	probably damaging	0.98
R1170:Nr4a3	UTSW	4	48083324	missense	probably benign	0.01
R1440:Nr4a3	UTSW	4	48051777	missense	probably benign
R1977:Nr4a3	UTSW	4	48056539	missense	probably damaging	1.00
R2016:Nr4a3	UTSW	4	48083252	missense	probably damaging	1.00
R2046:Nr4a3	UTSW	4	48067807	missense	possibly damaging	0.82
R2055:Nr4a3	UTSW	4	48067771	missense	possibly damaging	0.86
R3707:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R3708:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R4246:Nr4a3	UTSW	4	48083125	missense	possibly damaging	0.86
R4657:Nr4a3	UTSW	4	48051522	missense	probably damaging	1.00
R5434:Nr4a3	UTSW	4	48067861	missense	probably damaging	1.00
R5539:Nr4a3	UTSW	4	48056525	splice site	probably null
R5663:Nr4a3	UTSW	4	48055931	missense	probably damaging	1.00
R6513:Nr4a3	UTSW	4	48083255	missense	probably damaging	0.98
R6664:Nr4a3	UTSW	4	48056006	missense	probably damaging	1.00
R6921:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R6940:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R7076:Nr4a3	UTSW	4	48055957	missense	probably damaging	1.00
R7322:Nr4a3	UTSW	4	48083238	missense	probably benign	0.00
R7347:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7348:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7349:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7361:Nr4a3	UTSW	4	48083203	missense	probably benign	0.00
R7365:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7366:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7418:Nr4a3	UTSW	4	48051476	missense	probably damaging	1.00
R7659:Nr4a3	UTSW	4	48051269	missense	probably damaging	1.00
R7895:Nr4a3	UTSW	4	48051390	missense	probably benign
R7986:Nr4a3	UTSW	4	48055954	missense	probably damaging	1.00
R8022:Nr4a3	UTSW	4	48051510	missense	probably damaging	1.00
R8226:Nr4a3	UTSW	4	48056588	missense	probably damaging	1.00
R8328:Nr4a3	UTSW	4	48051323	missense	probably damaging	1.00
R8349:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40
R8403:Nr4a3	UTSW	4	48051348	missense	probably damaging	1.00
R8449:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- TCCTGCCTGTACCAAATGCC -3'
(R):5'- ATGAGCTCCTATTGGGTGGC -3'

Sequencing Primer
(F):5'- GTACCAAATGCCGCCTTCTGG -3'
(R):5'- AGACTGAGTGCAGCTGCG -3'

Posted On

2016-03-17