Incidental Mutation 'R4870:Ankle2'
ID376490
Institutional Source Beutler Lab
Gene Symbol Ankle2
Ensembl Gene ENSMUSG00000029501
Gene Nameankyrin repeat and LEM domain containing 2
Synonyms1110001J12Rik, D5Ertd585e
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110231004-110256651 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 110251478 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031474] [ENSMUST00000086674] [ENSMUST00000197188]
Predicted Effect probably null
Transcript: ENSMUST00000031474
SMART Domains Protein: ENSMUSP00000031474
Gene: ENSMUSG00000029501

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 74 112 6.6e-12 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 923 937 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086674
SMART Domains Protein: ENSMUSP00000083878
Gene: ENSMUSG00000029501

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 75 114 5.8e-9 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 845 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196821
Predicted Effect probably null
Transcript: ENSMUST00000197188
SMART Domains Protein: ENSMUSP00000143044
Gene: ENSMUSG00000029501

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:LEM 75 114 6.4e-9 PFAM
ANK 358 387 7.75e2 SMART
ANK 419 448 3.31e-1 SMART
low complexity region 923 937 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LEM family of inner nuclear membrane proteins. The encoded protein functions as a mitotic regulator through postmitotic formation of the nuclear envelope. Mutations in this gene cause morphology defects in the nuclear envelope and BAF hyperphosphorylation. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Ankle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Ankle2 APN 5 110234352 missense probably benign 0.01
IGL03030:Ankle2 APN 5 110251610 missense possibly damaging 0.93
R0107:Ankle2 UTSW 5 110253027 missense probably benign
R0219:Ankle2 UTSW 5 110251645 nonsense probably null
R0288:Ankle2 UTSW 5 110236390 missense probably damaging 0.96
R0511:Ankle2 UTSW 5 110242059 splice site probably benign
R1343:Ankle2 UTSW 5 110237966 missense probably damaging 1.00
R2079:Ankle2 UTSW 5 110244505 missense probably damaging 1.00
R3954:Ankle2 UTSW 5 110251675 missense probably benign 0.00
R4161:Ankle2 UTSW 5 110234368 missense probably benign 0.06
R4196:Ankle2 UTSW 5 110244543 missense possibly damaging 0.81
R4613:Ankle2 UTSW 5 110231379 missense probably benign
R4830:Ankle2 UTSW 5 110242013 missense probably damaging 1.00
R4946:Ankle2 UTSW 5 110253838 missense probably benign 0.06
R5537:Ankle2 UTSW 5 110249495 missense probably damaging 1.00
R5798:Ankle2 UTSW 5 110251535 missense probably damaging 1.00
R5809:Ankle2 UTSW 5 110237990 missense probably damaging 0.99
R6434:Ankle2 UTSW 5 110253893 missense probably damaging 1.00
R6825:Ankle2 UTSW 5 110250769 missense probably null 0.78
R7264:Ankle2 UTSW 5 110237823 missense probably damaging 1.00
R7296:Ankle2 UTSW 5 110237724 missense probably damaging 1.00
R7318:Ankle2 UTSW 5 110237766 missense probably benign 0.19
R7429:Ankle2 UTSW 5 110234518 missense possibly damaging 0.86
R8035:Ankle2 UTSW 5 110254452 missense probably damaging 1.00
R8079:Ankle2 UTSW 5 110231316 missense probably damaging 1.00
R8257:Ankle2 UTSW 5 110253915 critical splice donor site probably null
R8348:Ankle2 UTSW 5 110242043 missense possibly damaging 0.68
R8448:Ankle2 UTSW 5 110242043 missense possibly damaging 0.68
R8478:Ankle2 UTSW 5 110252952 missense possibly damaging 0.92
X0026:Ankle2 UTSW 5 110253120 missense probably benign 0.01
X0065:Ankle2 UTSW 5 110236357 missense probably damaging 0.99
Z1176:Ankle2 UTSW 5 110234499 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGTCACTTGCTATGTCAGAGTAACTC -3'
(R):5'- TGAGGTTCTGTCCTGAAGGC -3'

Sequencing Primer
(F):5'- GCTATGTCAGAGTAACTCCTCAAAGG -3'
(R):5'- AAGGCAGCCTTCATTTTCTCG -3'
Posted On2016-03-17