Incidental Mutation 'R4870:Mob1a'
ID376495
Institutional Source Beutler Lab
Gene Symbol Mob1a
Ensembl Gene ENSMUSG00000043131
Gene NameMOB kinase activator 1A
Synonyms4022402H07Rik, Mobk1b, Mobkl1b
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83326016-83343776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83340239 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 213 (S213P)
Ref Sequence ENSEMBL: ENSMUSP00000098802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038658] [ENSMUST00000055261] [ENSMUST00000101245]
Predicted Effect unknown
Transcript: ENSMUST00000038658
AA Change: S137P
SMART Domains Protein: ENSMUSP00000039115
Gene: ENSMUSG00000043131
AA Change: S137P

DomainStartEndE-ValueType
Pfam:Mob1_phocein 29 63 1.1e-9 PFAM
Pfam:Mob1_phocein 60 129 3.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055261
AA Change: S213P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000054452
Gene: ENSMUSG00000043131
AA Change: S213P

DomainStartEndE-ValueType
Pfam:Mob1_phocein 29 205 3.4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101245
AA Change: S213P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098802
Gene: ENSMUSG00000043131
AA Change: S213P

DomainStartEndE-ValueType
Mob1_phocein 31 204 1.26e-118 SMART
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the Hippo signaling pathway, which controls organ size and tumor growth by enhancing apoptosis. Loss of the encoded protein results in cell proliferation and cancer formation. The encoded protein is also involved in the control of microtubule stability during cytokinesis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Mob1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Mob1a APN 6 83332486 missense probably damaging 1.00
IGL00838:Mob1a APN 6 83338331 missense possibly damaging 0.94
IGL01685:Mob1a APN 6 83332503 missense probably benign 0.00
R0612:Mob1a UTSW 6 83334158 missense probably benign 0.31
R6682:Mob1a UTSW 6 83334150 missense possibly damaging 0.54
R7299:Mob1a UTSW 6 83338449 splice site probably null
R7417:Mob1a UTSW 6 83332510 missense probably benign 0.00
R7968:Mob1a UTSW 6 83338305 missense probably benign 0.00
R8324:Mob1a UTSW 6 83329974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCCAGAAGTCAGCACTG -3'
(R):5'- ATCTGGCCAACCTACCTTTG -3'

Sequencing Primer
(F):5'- CAACACTGGGCATTACTGGTTCAG -3'
(R):5'- GGGACAATTTTCTCTGCAAACAC -3'
Posted On2016-03-17