Mutagenetix > Incidental Mutations

Incidental Mutation 'R4870:Sytl2'

376505

Institutional Source

Beutler Lab

Gene Symbol

Sytl2

Ensembl Gene

ENSMUSG00000030616

Gene Name

synaptotagmin-like 2

Synonyms

Slp2-a, Slp2-b, Slp2-d, Slp2-c, Slp2

MMRRC Submission

042480-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.395) question?

Stock #

R4870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90302252-90410719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90388898 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 522 (N522I)

Ref Sequence

ENSEMBL: ENSMUSP00000139450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107210] [ENSMUST00000107211] [ENSMUST00000190731] [ENSMUST00000190837] [ENSMUST00000208720]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000098310

SMART Domains

Protein: ENSMUSP00000095912
Gene: ENSMUSG00000030616

Domain	Start	End	E-Value	Type
low complexity region	938	966	N/A	INTRINSIC
C2	990	1095	4.59e-15	SMART
C2	1139	1242	6.44e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107210
AA Change: N549I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102828
Gene: ENSMUSG00000030616
AA Change: N549I

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	5	59	5.5e-9	PFAM
low complexity region	192	205	N/A	INTRINSIC
low complexity region	317	328	N/A	INTRINSIC
C2	620	725	4.59e-15	SMART
C2	769	872	6.44e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107211

SMART Domains

Protein: ENSMUSP00000102829
Gene: ENSMUSG00000030616

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	5	59	5.6e-9	PFAM
low complexity region	192	205	N/A	INTRINSIC
low complexity region	317	328	N/A	INTRINSIC
low complexity region	592	620	N/A	INTRINSIC
C2	644	749	4.59e-15	SMART
C2	793	896	6.44e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190365

Predicted Effect

probably damaging
Transcript: ENSMUST00000190731
AA Change: N549I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139865
Gene: ENSMUSG00000030616
AA Change: N549I

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	5	59	5.8e-9	PFAM
low complexity region	192	205	N/A	INTRINSIC
low complexity region	317	328	N/A	INTRINSIC
low complexity region	608	636	N/A	INTRINSIC
C2	660	765	4.59e-15	SMART
C2	809	912	6.44e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000190837
AA Change: N522I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139450
Gene: ENSMUSG00000030616
AA Change: N522I

Domain	Start	End	E-Value	Type
Pfam:FYVE_2	5	59	5.6e-9	PFAM
low complexity region	82	93	N/A	INTRINSIC
low complexity region	165	178	N/A	INTRINSIC
low complexity region	290	301	N/A	INTRINSIC
low complexity region	581	609	N/A	INTRINSIC
C2	633	738	4.59e-15	SMART
C2	782	885	6.44e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207064

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207431

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207629

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207872

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207928

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208486

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208809

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209188

Predicted Effect

probably benign
Transcript: ENSMUST00000208720

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208580

Meta Mutation Damage Score

0.1380

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display abnormal gastric surface mucus cell morphology and reduced basal mucin secretion from gastric cells [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	C	A	7: 34,284,887	V104L	possibly damaging	Het
Abcb11	A	T	2: 69,239,196	I1285N	probably damaging	Het
Abcc8	G	A	7: 46,107,259	R721*	probably null	Het
Alox8	T	C	11: 69,186,568	Y423C	probably damaging	Het
Ankle2	T	A	5: 110,251,478		probably null	Het
Cdc14a	A	G	3: 116,423,460	I9T	probably benign	Het
Ceacam18	T	C	7: 43,641,904	C257R	probably damaging	Het
Cilp	T	C	9: 65,279,698	V1025A	probably damaging	Het
Clcn7	G	T	17: 25,153,565		probably benign	Het
Csnk1d	A	T	11: 120,983,188		probably benign	Het
Cyp11b2	A	G	15: 74,853,146	S285P	probably benign	Het
Dip2b	T	A	15: 100,195,784		probably null	Het
Dmrt1	T	A	19: 25,505,855	M1K	probably null	Het
Dnajc14	T	C	10: 128,817,350	V684A	probably benign	Het
Dnmt3b	A	G	2: 153,670,364	Q335R	probably benign	Het
Exoc3l2	T	A	7: 19,495,192	C772S	unknown	Het
F2rl1	A	T	13: 95,513,984	F130Y	probably damaging	Het
Galk2	C	G	2: 125,929,637	S194*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpbp1l1	A	G	4: 116,573,517	T62A	probably benign	Het
H2-Q10	A	T	17: 35,470,460	D53V	probably damaging	Het
H2-T22	T	C	17: 36,039,032	K356R	probably benign	Het
Insrr	G	A	3: 87,811,604	V956M	probably damaging	Het
Ints7	A	G	1: 191,596,331	T239A	probably damaging	Het
Isl1	A	G	13: 116,308,270		probably benign	Het
Kcng2	A	G	18: 80,322,868	C90R	probably benign	Het
Kif3c	C	T	12: 3,401,735	P171S	probably damaging	Het
Knl1	A	G	2: 119,081,513	T1704A	probably benign	Het
Lats1	A	G	10: 7,705,785	Y778C	probably damaging	Het
Limd2	T	C	11: 106,159,389	M1V	probably null	Het
Mcm10	A	T	2: 5,004,159	I333N	probably damaging	Het
Mipep	T	A	14: 60,802,880	L283*	probably null	Het
Mixl1	A	G	1: 180,694,672	S215P	probably benign	Het
Mmp21	A	G	7: 133,678,677	L188P	probably damaging	Het
Mob1a	T	C	6: 83,340,239	S213P	probably benign	Het
Ndufaf6	T	C	4: 11,060,917	T220A	probably benign	Het
Nr4a3	A	T	4: 48,051,651	Y135F	possibly damaging	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Obscn	A	T	11: 59,136,206	L57Q	probably damaging	Het
Olfr1161	T	C	2: 88,025,460	L246P	probably damaging	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pirb	T	A	7: 3,712,662	M839L	probably benign	Het
Plcl2	A	G	17: 50,607,226	E421G	possibly damaging	Het
Ppp1r12b	T	C	1: 134,949,033	N99S	probably benign	Het
Ptpro	A	G	6: 137,377,132	K169E	probably damaging	Het
Rita1	T	A	5: 120,611,383	K88N	probably damaging	Het
Rptn	A	T	3: 93,396,469	K370*	probably null	Het
Simc1	A	G	13: 54,539,763	D115G	probably null	Het
Stab1	T	A	14: 31,142,043	N136I	probably benign	Het
Syt4	T	A	18: 31,447,356		probably benign	Het
Tax1bp1	A	G	6: 52,729,493		probably benign	Het
Tenm2	A	T	11: 36,078,569	D847E	probably damaging	Het
Th	G	T	7: 142,894,097	D321E	probably benign	Het
Tmem44	A	T	16: 30,540,773	L46Q	probably damaging	Het
Trp53bp1	A	G	2: 121,256,641	L178P	probably damaging	Het
Trp63	A	G	16: 25,866,218	*285W	probably null	Het
Tsen34	T	C	7: 3,694,381		probably benign	Het
Tssk4	C	T	14: 55,651,815	T256I	probably benign	Het
Ttc17	A	T	2: 94,366,609	N464K	probably damaging	Het
Ttll2	C	T	17: 7,351,599	V310I	probably benign	Het
Ubn1	A	G	16: 5,077,313	E741G	probably damaging	Het
Urad	T	A	5: 147,315,454	I63F	probably damaging	Het
Vcan	T	C	13: 89,704,739	T701A	probably benign	Het
Vmn2r58	A	G	7: 41,837,215	V752A	possibly damaging	Het
Vmn2r69	C	A	7: 85,411,585	V264L	possibly damaging	Het
Zfp292	A	G	4: 34,808,917	S1376P	probably damaging	Het
Zfp955a	G	A	17: 33,241,725	R478*	probably null	Het
Znfx1	A	C	2: 167,055,269	F578L	probably benign	Het

Other mutations in Sytl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Sytl2	APN	7	90372905	missense	probably benign	0.25
IGL00657:Sytl2	APN	7	90401410	missense	probably benign	0.40
IGL00788:Sytl2	APN	7	90382698	intron	probably benign
IGL00834:Sytl2	APN	7	90382636	intron	probably benign
IGL01833:Sytl2	APN	7	90396537	missense	probably damaging	0.99
IGL01866:Sytl2	APN	7	90381839	intron	probably benign
IGL02215:Sytl2	APN	7	90381214	intron	probably benign
IGL02934:Sytl2	APN	7	90375992	missense	probably benign	0.00
IGL03095:Sytl2	APN	7	90392434	missense	probably damaging	1.00
finder	UTSW	7	90375652	missense	probably damaging	1.00
keeper	UTSW	7	90358224	nonsense	probably null
R0126:Sytl2	UTSW	7	90396589	missense	probably damaging	1.00
R0269:Sytl2	UTSW	7	90403020	splice site	probably benign
R0270:Sytl2	UTSW	7	90403020	splice site	probably benign
R0271:Sytl2	UTSW	7	90403020	splice site	probably benign
R0288:Sytl2	UTSW	7	90403020	splice site	probably benign
R0528:Sytl2	UTSW	7	90403020	splice site	probably benign
R0601:Sytl2	UTSW	7	90395166	missense	probably damaging	1.00
R0610:Sytl2	UTSW	7	90380853	intron	probably benign
R1634:Sytl2	UTSW	7	90395182	missense	probably damaging	1.00
R1777:Sytl2	UTSW	7	90403052	missense	probably benign	0.25
R2040:Sytl2	UTSW	7	90381861	intron	probably benign
R3788:Sytl2	UTSW	7	90376081	missense	probably benign	0.00
R3843:Sytl2	UTSW	7	90360159	missense	possibly damaging	0.77
R3952:Sytl2	UTSW	7	90381492	intron	probably benign
R4082:Sytl2	UTSW	7	90408427	missense	possibly damaging	0.88
R4600:Sytl2	UTSW	7	90375769	missense	probably benign	0.11
R4651:Sytl2	UTSW	7	90375425	missense	probably damaging	1.00
R4724:Sytl2	UTSW	7	90348792	start codon destroyed	probably null	1.00
R4730:Sytl2	UTSW	7	90381249	intron	probably benign
R4959:Sytl2	UTSW	7	90376037	missense	probably damaging	0.97
R4995:Sytl2	UTSW	7	90382257	intron	probably benign
R5009:Sytl2	UTSW	7	90381315	intron	probably benign
R5096:Sytl2	UTSW	7	90376082	missense	possibly damaging	0.49
R5191:Sytl2	UTSW	7	90375652	missense	probably damaging	1.00
R5305:Sytl2	UTSW	7	90381863	intron	probably benign
R5538:Sytl2	UTSW	7	90388906	missense	probably benign	0.03
R5792:Sytl2	UTSW	7	90375689	missense	probably damaging	0.98
R6378:Sytl2	UTSW	7	90358224	nonsense	probably null
R6982:Sytl2	UTSW	7	90396564	missense	probably damaging	0.96
R7456:Sytl2	UTSW	7	90348847	missense	probably damaging	1.00
R7600:Sytl2	UTSW	7	90376144	missense	probably benign	0.00
R8127:Sytl2	UTSW	7	90375590	missense	possibly damaging	0.93
R8171:Sytl2	UTSW	7	90409470	missense	probably damaging	1.00
R8225:Sytl2	UTSW	7	90375517	missense	probably benign	0.36
R8297:Sytl2	UTSW	7	90385075	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAAGCTGAAAACCTGTCAGAG -3'
(R):5'- CTTCAGATACACAAGTCTCCTTTAGTG -3'

Sequencing Primer
(F):5'- CAGAGGAACTCTGCAACTT -3'
(R):5'- TGCCAGCTTTGGAGATAT -3'

Posted On

2016-03-17