Incidental Mutation 'R4870:Olfr603'
ID376506
Institutional Source Beutler Lab
Gene Symbol Olfr603
Ensembl Gene ENSMUSG00000059874
Gene Nameolfactory receptor 603
SynonymsMOR32-2, GA_x6K02T2PBJ9-6092550-6092362, MOR32-14_i, GA_x6K02T2PBJ9-6096387-6095449, Olfr604
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103383062-103386177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103383633 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 123 (D123V)
Ref Sequence ENSEMBL: ENSMUSP00000151321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071844] [ENSMUST00000218246]
Predicted Effect probably damaging
Transcript: ENSMUST00000071844
AA Change: D123V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071744
Gene: ENSMUSG00000059874
AA Change: D123V

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.7e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 210 1.9e-10 PFAM
Pfam:7tm_1 43 293 5.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218246
AA Change: D123V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6786 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Olfr603
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Olfr603 APN 7 103383465 missense probably damaging 0.98
IGL01582:Olfr603 APN 7 103383599 nonsense probably null
IGL01788:Olfr603 APN 7 103383563 missense probably benign 0.00
IGL02837:Olfr603 UTSW 7 103383615 missense probably damaging 1.00
R1807:Olfr603 UTSW 7 103383583 missense probably benign 0.25
R2097:Olfr603 UTSW 7 103383633 missense probably damaging 1.00
R2161:Olfr603 UTSW 7 103383200 missense probably benign 0.01
R5116:Olfr603 UTSW 7 103383864 missense probably benign 0.03
R6263:Olfr603 UTSW 7 103383196 missense possibly damaging 0.88
R6385:Olfr603 UTSW 7 103383897 missense possibly damaging 0.61
R6980:Olfr603 UTSW 7 103383096 missense probably benign 0.01
R7474:Olfr603 UTSW 7 103383762 missense probably damaging 0.99
R7754:Olfr603 UTSW 7 103383738 missense probably damaging 1.00
R7842:Olfr603 UTSW 7 103383576 missense probably benign 0.00
R7947:Olfr603 UTSW 7 103383528 missense possibly damaging 0.95
R7980:Olfr603 UTSW 7 103383763 missense probably damaging 0.99
R8176:Olfr603 UTSW 7 103383864 missense probably benign 0.03
R8523:Olfr603 UTSW 7 103383206 missense probably benign 0.31
Z1177:Olfr603 UTSW 7 103383802 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTATCCCCATATGTTCACAG -3'
(R):5'- TGAACAGAGTCTTCACCAGCC -3'

Sequencing Primer
(F):5'- CCCATATGTTCACAGTAGGTATGAGG -3'
(R):5'- AGAGTCTTCACCAGCCCATGTTC -3'
Posted On2016-03-17