Incidental Mutation 'R4870:Th'
ID376508
Institutional Source Beutler Lab
Gene Symbol Th
Ensembl Gene ENSMUSG00000000214
Gene Nametyrosine hydroxylase
Synonyms
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location142892752-142931128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 142894097 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 321 (D321E)
Ref Sequence ENSEMBL: ENSMUSP00000101549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000219] [ENSMUST00000105929] [ENSMUST00000123057] [ENSMUST00000124951] [ENSMUST00000140344]
Predicted Effect probably benign
Transcript: ENSMUST00000000219
AA Change: D416E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000219
Gene: ENSMUSG00000000214
AA Change: D416E

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 2.3e-15 PFAM
Pfam:TOH_N 29 49 2.6e-11 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 1e-49 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 495 1.2e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105929
AA Change: D321E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101549
Gene: ENSMUSG00000000214
AA Change: D321E

DomainStartEndE-ValueType
PDB:2MDA|B 8 51 1e-21 PDB
low complexity region 52 63 N/A INTRINSIC
Pfam:Biopterin_H 70 401 2.2e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123057
Predicted Effect probably benign
Transcript: ENSMUST00000124951
SMART Domains Protein: ENSMUSP00000122876
Gene: ENSMUSG00000000214

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 5e-16 PFAM
Pfam:TOH_N 28 49 4.1e-10 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 2e-52 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 232 7.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138482
Predicted Effect probably benign
Transcript: ENSMUST00000140344
SMART Domains Protein: ENSMUSP00000115434
Gene: ENSMUSG00000000214

DomainStartEndE-ValueType
Pfam:TOH_N 11 29 5.2e-9 PFAM
low complexity region 31 43 N/A INTRINSIC
PDB:2MDA|B 45 126 7e-53 PDB
low complexity region 127 138 N/A INTRINSIC
Pfam:Biopterin_H 145 171 3.9e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the conversion of tyrosine to dopamine. It is the rate-limiting enzyme in the synthesis of catecholamines, hence plays a key role in the physiology of adrenergic neurons. Mutations in this gene have been associated with autosomal recessive Segawa syndrome. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are deficient in catecholamines, and usually die around embryonic day 11.5-15.5 due to cardiac failure. Treatment of the pregnant female with dihydroxyphenylalanine prevents prenatal mortality. Mice homozygous for hypomorphic targeted alleles are hypokinetic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Th
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Th APN 7 142897026 missense probably benign 0.01
IGL02308:Th APN 7 142898057 missense possibly damaging 0.69
IGL02417:Th APN 7 142899906 missense probably damaging 1.00
IGL02565:Th APN 7 142899910 missense probably damaging 1.00
IGL02896:Th APN 7 142895431 missense probably damaging 1.00
R0311:Th UTSW 7 142896041 missense probably damaging 1.00
R1072:Th UTSW 7 142894488 missense probably benign
R1595:Th UTSW 7 142897008 missense probably benign 0.06
R1756:Th UTSW 7 142898166 nonsense probably null
R2091:Th UTSW 7 142895543 missense probably damaging 0.98
R2850:Th UTSW 7 142894075 nonsense probably null
R3151:Th UTSW 7 142894075 nonsense probably null
R4458:Th UTSW 7 142896953 missense probably benign 0.41
R5382:Th UTSW 7 142895440 missense probably damaging 1.00
R7874:Th UTSW 7 142895571 nonsense probably null
R8049:Th UTSW 7 142894123 missense probably damaging 1.00
R8425:Th UTSW 7 142894086 missense possibly damaging 0.86
R8431:Th UTSW 7 142893064 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGTGTACTAAATGGGCTCTC -3'
(R):5'- ATCAGAAGGGTCCTTGGCTC -3'

Sequencing Primer
(F):5'- AGTGTACTAAATGGGCTCTCAAGTG -3'
(R):5'- AAGGGTCCTTGGCTCAGGTC -3'
Posted On2016-03-17