Incidental Mutation 'R4870:Lats1'
ID376510
Institutional Source Beutler Lab
Gene Symbol Lats1
Ensembl Gene ENSMUSG00000040021
Gene Namelarge tumor suppressor
Synonyms
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7681214-7716460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7705785 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 778 (Y778C)
Ref Sequence ENSEMBL: ENSMUSP00000151533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]
Predicted Effect probably damaging
Transcript: ENSMUST00000040043
AA Change: Y778C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: Y778C

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165952
AA Change: Y778C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: Y778C

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217931
AA Change: Y778C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Lats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lats1 APN 10 7691566 missense probably damaging 0.99
IGL00595:Lats1 APN 10 7702305 missense probably benign 0.00
IGL00932:Lats1 APN 10 7712742 missense possibly damaging 0.69
IGL01019:Lats1 APN 10 7705671 missense probably damaging 1.00
IGL01380:Lats1 APN 10 7691780 missense possibly damaging 0.69
IGL01965:Lats1 APN 10 7701706 missense probably benign 0.10
IGL02027:Lats1 APN 10 7712948 missense probably benign
IGL02611:Lats1 APN 10 7705787 missense possibly damaging 0.91
IGL02997:Lats1 APN 10 7702254 missense possibly damaging 0.53
IGL03107:Lats1 APN 10 7712746 missense probably benign 0.15
I1329:Lats1 UTSW 10 7712802 missense probably benign 0.10
PIT4378001:Lats1 UTSW 10 7705605 missense probably damaging 1.00
R0153:Lats1 UTSW 10 7691575 missense probably damaging 1.00
R0568:Lats1 UTSW 10 7712528 missense possibly damaging 0.69
R0581:Lats1 UTSW 10 7702941 missense possibly damaging 0.67
R0604:Lats1 UTSW 10 7712661 missense probably damaging 0.96
R1681:Lats1 UTSW 10 7705914 missense probably damaging 0.99
R1694:Lats1 UTSW 10 7701945 missense probably benign 0.07
R1840:Lats1 UTSW 10 7710939 nonsense probably null
R1914:Lats1 UTSW 10 7710457 splice site probably benign
R2137:Lats1 UTSW 10 7701847 missense possibly damaging 0.71
R2317:Lats1 UTSW 10 7691776 nonsense probably null
R3863:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R3864:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R4597:Lats1 UTSW 10 7691746 missense probably benign 0.00
R4657:Lats1 UTSW 10 7705684 missense possibly damaging 0.82
R4658:Lats1 UTSW 10 7702729 missense probably benign
R4663:Lats1 UTSW 10 7712583 missense probably damaging 1.00
R5101:Lats1 UTSW 10 7712584 nonsense probably null
R5134:Lats1 UTSW 10 7691811 missense probably benign 0.34
R5150:Lats1 UTSW 10 7712651 missense probably benign
R5546:Lats1 UTSW 10 7705754 missense probably damaging 0.99
R5820:Lats1 UTSW 10 7705908 missense probably damaging 1.00
R6006:Lats1 UTSW 10 7705595 missense probably damaging 1.00
R6301:Lats1 UTSW 10 7703107 missense probably benign 0.01
R6544:Lats1 UTSW 10 7701670 missense possibly damaging 0.94
R6647:Lats1 UTSW 10 7697507 missense possibly damaging 0.81
R6874:Lats1 UTSW 10 7710851 missense probably damaging 1.00
R7328:Lats1 UTSW 10 7705547 missense possibly damaging 0.62
R7390:Lats1 UTSW 10 7702095 nonsense probably null
R7438:Lats1 UTSW 10 7712942 nonsense probably null
R7457:Lats1 UTSW 10 7710891 missense probably damaging 1.00
R7524:Lats1 UTSW 10 7701978 missense possibly damaging 0.89
R7593:Lats1 UTSW 10 7701712 missense probably damaging 1.00
R7736:Lats1 UTSW 10 7702364 missense probably damaging 1.00
R7884:Lats1 UTSW 10 7697526 nonsense probably null
R7967:Lats1 UTSW 10 7697526 nonsense probably null
RF021:Lats1 UTSW 10 7710608 missense probably damaging 1.00
X0026:Lats1 UTSW 10 7710623 missense probably damaging 1.00
X0053:Lats1 UTSW 10 7691609 missense probably benign 0.00
Z1176:Lats1 UTSW 10 7705809 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAAGTCTGTCTAGCAAG -3'
(R):5'- GTGCACAAGCCAAAGTCAGTC -3'

Sequencing Primer
(F):5'- GTCTGTCTAGCAAGAAAAGTCGATAC -3'
(R):5'- GTCAATTTAATATGGCCATCACGGTC -3'
Posted On2016-03-17