Incidental Mutation 'R4870:Lats1'
ID 376510
Institutional Source Beutler Lab
Gene Symbol Lats1
Ensembl Gene ENSMUSG00000040021
Gene Name large tumor suppressor
Synonyms
MMRRC Submission 042480-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.847) question?
Stock # R4870 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 7556978-7592224 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7581549 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 778 (Y778C)
Ref Sequence ENSEMBL: ENSMUSP00000151533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]
AlphaFold Q8BYR2
Predicted Effect probably damaging
Transcript: ENSMUST00000040043
AA Change: Y778C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: Y778C

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165952
AA Change: Y778C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: Y778C

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217931
AA Change: Y778C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,069,540 (GRCm39) I1285N probably damaging Het
Abcc8 G A 7: 45,756,683 (GRCm39) R721* probably null Het
Alox8 T C 11: 69,077,394 (GRCm39) Y423C probably damaging Het
Ankle2 T A 5: 110,399,344 (GRCm39) probably null Het
Cdc14a A G 3: 116,217,109 (GRCm39) I9T probably benign Het
Ceacam18 T C 7: 43,291,328 (GRCm39) C257R probably damaging Het
Cilp T C 9: 65,186,980 (GRCm39) V1025A probably damaging Het
Clcn7 G T 17: 25,372,539 (GRCm39) probably benign Het
Csnk1d A T 11: 120,874,014 (GRCm39) probably benign Het
Cyp11b2 A G 15: 74,724,995 (GRCm39) S285P probably benign Het
Dip2b T A 15: 100,093,665 (GRCm39) probably null Het
Dmrt1 T A 19: 25,483,219 (GRCm39) M1K probably null Het
Dnajc14 T C 10: 128,653,219 (GRCm39) V684A probably benign Het
Dnmt3b A G 2: 153,512,284 (GRCm39) Q335R probably benign Het
Exoc3l2 T A 7: 19,229,117 (GRCm39) C772S unknown Het
F2rl1 A T 13: 95,650,492 (GRCm39) F130Y probably damaging Het
Galk2 C G 2: 125,771,557 (GRCm39) S194* probably null Het
Garre1 C A 7: 33,984,312 (GRCm39) V104L possibly damaging Het
Gpbp1l1 A G 4: 116,430,714 (GRCm39) T62A probably benign Het
H2-Q10 A T 17: 35,781,357 (GRCm39) D53V probably damaging Het
H2-T22 T C 17: 36,349,924 (GRCm39) K356R probably benign Het
Insrr G A 3: 87,718,911 (GRCm39) V956M probably damaging Het
Ints7 A G 1: 191,328,443 (GRCm39) T239A probably damaging Het
Isl1 A G 13: 116,444,806 (GRCm39) probably benign Het
Kcng2 A G 18: 80,366,083 (GRCm39) C90R probably benign Het
Kif3c C T 12: 3,451,735 (GRCm39) P171S probably damaging Het
Knl1 A G 2: 118,911,994 (GRCm39) T1704A probably benign Het
Limd2 T C 11: 106,050,215 (GRCm39) M1V probably null Het
Mcm10 A T 2: 5,008,970 (GRCm39) I333N probably damaging Het
Mipep T A 14: 61,040,329 (GRCm39) L283* probably null Het
Mixl1 A G 1: 180,522,237 (GRCm39) S215P probably benign Het
Mmp21 A G 7: 133,280,406 (GRCm39) L188P probably damaging Het
Mob1a T C 6: 83,317,221 (GRCm39) S213P probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Ndufaf6 T C 4: 11,060,917 (GRCm39) T220A probably benign Het
Nr4a3 A T 4: 48,051,651 (GRCm39) Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,103,852 (GRCm39) probably benign Het
Obscn A T 11: 59,027,032 (GRCm39) L57Q probably damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or5d35 T C 2: 87,855,804 (GRCm39) L246P probably damaging Het
Pirb T A 7: 3,715,661 (GRCm39) M839L probably benign Het
Plcl2 A G 17: 50,914,254 (GRCm39) E421G possibly damaging Het
Ppp1r12b T C 1: 134,876,771 (GRCm39) N99S probably benign Het
Ptpro A G 6: 137,354,130 (GRCm39) K169E probably damaging Het
Rita1 T A 5: 120,749,448 (GRCm39) K88N probably damaging Het
Rptn A T 3: 93,303,776 (GRCm39) K370* probably null Het
Simc1 A G 13: 54,687,576 (GRCm39) D115G probably null Het
Stab1 T A 14: 30,864,000 (GRCm39) N136I probably benign Het
Syt4 T A 18: 31,580,409 (GRCm39) probably benign Het
Sytl2 A T 7: 90,038,106 (GRCm39) N522I probably damaging Het
Tax1bp1 A G 6: 52,706,478 (GRCm39) probably benign Het
Tenm2 A T 11: 35,969,396 (GRCm39) D847E probably damaging Het
Th G T 7: 142,447,834 (GRCm39) D321E probably benign Het
Tmem44 A T 16: 30,359,591 (GRCm39) L46Q probably damaging Het
Trp53bp1 A G 2: 121,087,122 (GRCm39) L178P probably damaging Het
Trp63 A G 16: 25,684,968 (GRCm39) *285W probably null Het
Tsen34 T C 7: 3,697,380 (GRCm39) probably benign Het
Tssk4 C T 14: 55,889,272 (GRCm39) T256I probably benign Het
Ttc17 A T 2: 94,196,954 (GRCm39) N464K probably damaging Het
Ttll2 C T 17: 7,618,998 (GRCm39) V310I probably benign Het
Ubn1 A G 16: 4,895,177 (GRCm39) E741G probably damaging Het
Urad T A 5: 147,252,264 (GRCm39) I63F probably damaging Het
Vcan T C 13: 89,852,858 (GRCm39) T701A probably benign Het
Vmn2r58 A G 7: 41,486,639 (GRCm39) V752A possibly damaging Het
Vmn2r69 C A 7: 85,060,793 (GRCm39) V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 (GRCm39) S1376P probably damaging Het
Zfp955a G A 17: 33,460,699 (GRCm39) R478* probably null Het
Znfx1 A C 2: 166,897,189 (GRCm39) F578L probably benign Het
Other mutations in Lats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lats1 APN 10 7,567,330 (GRCm39) missense probably damaging 0.99
IGL00595:Lats1 APN 10 7,578,069 (GRCm39) missense probably benign 0.00
IGL00932:Lats1 APN 10 7,588,506 (GRCm39) missense possibly damaging 0.69
IGL01019:Lats1 APN 10 7,581,435 (GRCm39) missense probably damaging 1.00
IGL01380:Lats1 APN 10 7,567,544 (GRCm39) missense possibly damaging 0.69
IGL01965:Lats1 APN 10 7,577,470 (GRCm39) missense probably benign 0.10
IGL02027:Lats1 APN 10 7,588,712 (GRCm39) missense probably benign
IGL02611:Lats1 APN 10 7,581,551 (GRCm39) missense possibly damaging 0.91
IGL02997:Lats1 APN 10 7,578,018 (GRCm39) missense possibly damaging 0.53
IGL03107:Lats1 APN 10 7,588,510 (GRCm39) missense probably benign 0.15
I1329:Lats1 UTSW 10 7,588,566 (GRCm39) missense probably benign 0.10
PIT4378001:Lats1 UTSW 10 7,581,369 (GRCm39) missense probably damaging 1.00
R0153:Lats1 UTSW 10 7,567,339 (GRCm39) missense probably damaging 1.00
R0568:Lats1 UTSW 10 7,588,292 (GRCm39) missense possibly damaging 0.69
R0581:Lats1 UTSW 10 7,578,705 (GRCm39) missense possibly damaging 0.67
R0604:Lats1 UTSW 10 7,588,425 (GRCm39) missense probably damaging 0.96
R1681:Lats1 UTSW 10 7,581,678 (GRCm39) missense probably damaging 0.99
R1694:Lats1 UTSW 10 7,577,709 (GRCm39) missense probably benign 0.07
R1840:Lats1 UTSW 10 7,586,703 (GRCm39) nonsense probably null
R1914:Lats1 UTSW 10 7,586,221 (GRCm39) splice site probably benign
R2137:Lats1 UTSW 10 7,577,611 (GRCm39) missense possibly damaging 0.71
R2317:Lats1 UTSW 10 7,567,540 (GRCm39) nonsense probably null
R3863:Lats1 UTSW 10 7,581,510 (GRCm39) missense probably damaging 1.00
R3864:Lats1 UTSW 10 7,581,510 (GRCm39) missense probably damaging 1.00
R4597:Lats1 UTSW 10 7,567,510 (GRCm39) missense probably benign 0.00
R4657:Lats1 UTSW 10 7,581,448 (GRCm39) missense possibly damaging 0.82
R4658:Lats1 UTSW 10 7,578,493 (GRCm39) missense probably benign
R4663:Lats1 UTSW 10 7,588,347 (GRCm39) missense probably damaging 1.00
R5101:Lats1 UTSW 10 7,588,348 (GRCm39) nonsense probably null
R5134:Lats1 UTSW 10 7,567,575 (GRCm39) missense probably benign 0.34
R5150:Lats1 UTSW 10 7,588,415 (GRCm39) missense probably benign
R5546:Lats1 UTSW 10 7,581,518 (GRCm39) missense probably damaging 0.99
R5820:Lats1 UTSW 10 7,581,672 (GRCm39) missense probably damaging 1.00
R6006:Lats1 UTSW 10 7,581,359 (GRCm39) missense probably damaging 1.00
R6301:Lats1 UTSW 10 7,578,871 (GRCm39) missense probably benign 0.01
R6544:Lats1 UTSW 10 7,577,434 (GRCm39) missense possibly damaging 0.94
R6647:Lats1 UTSW 10 7,573,271 (GRCm39) missense possibly damaging 0.81
R6874:Lats1 UTSW 10 7,586,615 (GRCm39) missense probably damaging 1.00
R7328:Lats1 UTSW 10 7,581,311 (GRCm39) missense possibly damaging 0.62
R7390:Lats1 UTSW 10 7,577,859 (GRCm39) nonsense probably null
R7438:Lats1 UTSW 10 7,588,706 (GRCm39) nonsense probably null
R7457:Lats1 UTSW 10 7,586,655 (GRCm39) missense probably damaging 1.00
R7524:Lats1 UTSW 10 7,577,742 (GRCm39) missense possibly damaging 0.89
R7593:Lats1 UTSW 10 7,577,476 (GRCm39) missense probably damaging 1.00
R7736:Lats1 UTSW 10 7,578,128 (GRCm39) missense probably damaging 1.00
R7884:Lats1 UTSW 10 7,573,290 (GRCm39) nonsense probably null
R8166:Lats1 UTSW 10 7,577,880 (GRCm39) missense probably benign
R8248:Lats1 UTSW 10 7,581,667 (GRCm39) missense probably damaging 1.00
R8458:Lats1 UTSW 10 7,586,688 (GRCm39) nonsense probably null
R8477:Lats1 UTSW 10 7,581,279 (GRCm39) missense probably damaging 1.00
R8547:Lats1 UTSW 10 7,588,613 (GRCm39) missense probably damaging 1.00
R9163:Lats1 UTSW 10 7,578,052 (GRCm39) missense probably benign
R9441:Lats1 UTSW 10 7,578,681 (GRCm39) missense probably damaging 0.96
R9673:Lats1 UTSW 10 7,588,387 (GRCm39) missense probably benign 0.29
RF021:Lats1 UTSW 10 7,586,372 (GRCm39) missense probably damaging 1.00
X0026:Lats1 UTSW 10 7,586,387 (GRCm39) missense probably damaging 1.00
X0053:Lats1 UTSW 10 7,567,373 (GRCm39) missense probably benign 0.00
Z1176:Lats1 UTSW 10 7,581,573 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAAGTCTGTCTAGCAAG -3'
(R):5'- GTGCACAAGCCAAAGTCAGTC -3'

Sequencing Primer
(F):5'- GTCTGTCTAGCAAGAAAAGTCGATAC -3'
(R):5'- GTCAATTTAATATGGCCATCACGGTC -3'
Posted On 2016-03-17