Incidental Mutation 'R4870:Csnk1d'
ID376517
Institutional Source Beutler Lab
Gene Symbol Csnk1d
Ensembl Gene ENSMUSG00000025162
Gene Namecasein kinase 1, delta
Synonyms
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120961749-120991330 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 120983188 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000018274] [ENSMUST00000070575]
Predicted Effect probably benign
Transcript: ENSMUST00000018274
SMART Domains Protein: ENSMUSP00000018274
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 3.7e-18 PFAM
Pfam:Pkinase 9 277 1.8e-28 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070575
SMART Domains Protein: ENSMUSP00000070721
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 1.6e-18 PFAM
Pfam:Pkinase 9 280 2.8e-41 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146837
SMART Domains Protein: ENSMUSP00000115055
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase 2 55 6.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154483
SMART Domains Protein: ENSMUSP00000117472
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 27 210 2.5e-12 PFAM
Pfam:Pkinase 28 218 3.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155070
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a member of the casein kinase I (CKI) family of serine/threonine protein kinases. A highly similar human protein regulates an array of cellular processes by influencing the Wnt and hedgehog signaling pathways. The encoded protein may also be involved in the regulation of apoptosis, circadian rhythm, microtubule dynamics, chromosome segregation, and p53-mediated effects on growth. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die 1.5 to 5 days after birth and fetal weight is significantly smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Csnk1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Csnk1d APN 11 120971567 missense probably benign 0.06
IGL01905:Csnk1d APN 11 120973963 missense probably damaging 1.00
IGL02476:Csnk1d APN 11 120972512 missense probably damaging 1.00
R1971:Csnk1d UTSW 11 120972448 missense possibly damaging 0.95
R2245:Csnk1d UTSW 11 120972403 missense probably damaging 1.00
R4472:Csnk1d UTSW 11 120964974 unclassified probably benign
R4767:Csnk1d UTSW 11 120969128 missense probably benign
R4809:Csnk1d UTSW 11 120963842 unclassified probably benign
R6522:Csnk1d UTSW 11 120971623 missense probably damaging 1.00
R6657:Csnk1d UTSW 11 120964994 missense possibly damaging 0.75
RF009:Csnk1d UTSW 11 120971627 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTGTGACAAGGAGCACCATG -3'
(R):5'- TCCTGCCTCACAAAGATGTAATG -3'

Sequencing Primer
(F):5'- CTGTGACAAGGAGCACCATGTTTAC -3'
(R):5'- GCCTCACAAAGATGTAATGGATATC -3'
Posted On2016-03-17