Mutagenetix > Incidental Mutation

Incidental Mutation 'R4870:Stab1'

376523

Institutional Source

Beutler Lab

Gene Symbol

Stab1

Ensembl Gene

ENSMUSG00000042286

Gene Name

stabilin 1

Synonyms

MS-1

MMRRC Submission

042480-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31139013-31168641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31142043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 136 (N136I)

Ref Sequence

ENSEMBL: ENSMUSP00000125542 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000090212] [ENSMUST00000159249] [ENSMUST00000160024] [ENSMUST00000227096] [ENSMUST00000227794]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000036618
AA Change: N1996I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: N1996I

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	112	149	6.65e-2	SMART
EGF	160	194	2.28e0	SMART
EGF	199	232	1.4e0	SMART
EGF	236	272	4.97e-1	SMART
EGF	276	319	1.95e1	SMART
EGF_like	321	357	5.03e1	SMART
low complexity region	400	413	N/A	INTRINSIC
Blast:FAS1	414	501	2e-52	BLAST
FAS1	543	645	1.35e-24	SMART
EGF_like	780	817	5.45e1	SMART
EGF	822	861	1.08e-1	SMART
EGF	865	904	3.15e-3	SMART
EGF	908	947	1.3e1	SMART
EGF	951	989	1.47e1	SMART
FAS1	1023	1122	1.3e-17	SMART
FAS1	1165	1257	2.94e0	SMART
EGF	1332	1369	1.4e0	SMART
EGF	1379	1413	1.88e-1	SMART
EGF	1420	1455	6.02e0	SMART
EGF	1459	1497	3.82e-2	SMART
EGF	1501	1540	2.05e-2	SMART
EGF	1544	1583	2.25e1	SMART
FAS1	1616	1712	1.61e-22	SMART
FAS1	1763	1868	2.12e-17	SMART
EGF	1970	2007	1.26e-2	SMART
EGF	2017	2051	1.61e0	SMART
EGF	2059	2090	2.45e0	SMART
EGF	2094	2131	3.46e0	SMART
EGF	2135	2174	3.82e-2	SMART
LINK	2206	2301	8.55e-49	SMART
FAS1	2367	2462	2.06e-6	SMART
transmembrane domain	2476	2498	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090212

SMART Domains

Protein: ENSMUSP00000087680
Gene: ENSMUSG00000071547

Domain	Start	End	E-Value	Type
Pfam:5_nucleotid	1	367	1.5e-123	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159208

Predicted Effect

probably benign
Transcript: ENSMUST00000159249
AA Change: N136I

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286
AA Change: N136I

Domain	Start	End	E-Value	Type
EGF	110	147	1.26e-2	SMART
EGF	157	191	1.61e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159480

Predicted Effect

probably benign
Transcript: ENSMUST00000160024

SMART Domains

Protein: ENSMUSP00000125239
Gene: ENSMUSG00000042286

Domain	Start	End	E-Value	Type
Blast:FAS1	1	32	5e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160720

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162169

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162763

Predicted Effect

probably benign
Transcript: ENSMUST00000226975

Predicted Effect

probably benign
Transcript: ENSMUST00000227096

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227690

Predicted Effect

probably benign
Transcript: ENSMUST00000227794

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	C	A	7: 34,284,887	V104L	possibly damaging	Het
Abcb11	A	T	2: 69,239,196	I1285N	probably damaging	Het
Abcc8	G	A	7: 46,107,259	R721*	probably null	Het
Alox8	T	C	11: 69,186,568	Y423C	probably damaging	Het
Ankle2	T	A	5: 110,251,478		probably null	Het
Cdc14a	A	G	3: 116,423,460	I9T	probably benign	Het
Ceacam18	T	C	7: 43,641,904	C257R	probably damaging	Het
Cilp	T	C	9: 65,279,698	V1025A	probably damaging	Het
Clcn7	G	T	17: 25,153,565		probably benign	Het
Csnk1d	A	T	11: 120,983,188		probably benign	Het
Cyp11b2	A	G	15: 74,853,146	S285P	probably benign	Het
Dip2b	T	A	15: 100,195,784		probably null	Het
Dmrt1	T	A	19: 25,505,855	M1K	probably null	Het
Dnajc14	T	C	10: 128,817,350	V684A	probably benign	Het
Dnmt3b	A	G	2: 153,670,364	Q335R	probably benign	Het
Exoc3l2	T	A	7: 19,495,192	C772S	unknown	Het
F2rl1	A	T	13: 95,513,984	F130Y	probably damaging	Het
Galk2	C	G	2: 125,929,637	S194*	probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpbp1l1	A	G	4: 116,573,517	T62A	probably benign	Het
H2-Q10	A	T	17: 35,470,460	D53V	probably damaging	Het
H2-T22	T	C	17: 36,039,032	K356R	probably benign	Het
Insrr	G	A	3: 87,811,604	V956M	probably damaging	Het
Ints7	A	G	1: 191,596,331	T239A	probably damaging	Het
Isl1	A	G	13: 116,308,270		probably benign	Het
Kcng2	A	G	18: 80,322,868	C90R	probably benign	Het
Kif3c	C	T	12: 3,401,735	P171S	probably damaging	Het
Knl1	A	G	2: 119,081,513	T1704A	probably benign	Het
Lats1	A	G	10: 7,705,785	Y778C	probably damaging	Het
Limd2	T	C	11: 106,159,389	M1V	probably null	Het
Mcm10	A	T	2: 5,004,159	I333N	probably damaging	Het
Mipep	T	A	14: 60,802,880	L283*	probably null	Het
Mixl1	A	G	1: 180,694,672	S215P	probably benign	Het
Mmp21	A	G	7: 133,678,677	L188P	probably damaging	Het
Mob1a	T	C	6: 83,340,239	S213P	probably benign	Het
Ndufaf6	T	C	4: 11,060,917	T220A	probably benign	Het
Nr4a3	A	T	4: 48,051,651	Y135F	possibly damaging	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Obscn	A	T	11: 59,136,206	L57Q	probably damaging	Het
Olfr1161	T	C	2: 88,025,460	L246P	probably damaging	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pirb	T	A	7: 3,712,662	M839L	probably benign	Het
Plcl2	A	G	17: 50,607,226	E421G	possibly damaging	Het
Ppp1r12b	T	C	1: 134,949,033	N99S	probably benign	Het
Ptpro	A	G	6: 137,377,132	K169E	probably damaging	Het
Rita1	T	A	5: 120,611,383	K88N	probably damaging	Het
Rptn	A	T	3: 93,396,469	K370*	probably null	Het
Simc1	A	G	13: 54,539,763	D115G	probably null	Het
Syt4	T	A	18: 31,447,356		probably benign	Het
Sytl2	A	T	7: 90,388,898	N522I	probably damaging	Het
Tax1bp1	A	G	6: 52,729,493		probably benign	Het
Tenm2	A	T	11: 36,078,569	D847E	probably damaging	Het
Th	G	T	7: 142,894,097	D321E	probably benign	Het
Tmem44	A	T	16: 30,540,773	L46Q	probably damaging	Het
Trp53bp1	A	G	2: 121,256,641	L178P	probably damaging	Het
Trp63	A	G	16: 25,866,218	*285W	probably null	Het
Tsen34	T	C	7: 3,694,381		probably benign	Het
Tssk4	C	T	14: 55,651,815	T256I	probably benign	Het
Ttc17	A	T	2: 94,366,609	N464K	probably damaging	Het
Ttll2	C	T	17: 7,351,599	V310I	probably benign	Het
Ubn1	A	G	16: 5,077,313	E741G	probably damaging	Het
Urad	T	A	5: 147,315,454	I63F	probably damaging	Het
Vcan	T	C	13: 89,704,739	T701A	probably benign	Het
Vmn2r58	A	G	7: 41,837,215	V752A	possibly damaging	Het
Vmn2r69	C	A	7: 85,411,585	V264L	possibly damaging	Het
Zfp292	A	G	4: 34,808,917	S1376P	probably damaging	Het
Zfp955a	G	A	17: 33,241,725	R478*	probably null	Het
Znfx1	A	C	2: 167,055,269	F578L	probably benign	Het

Other mutations in Stab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Stab1	APN	14	31161357	missense	probably benign	0.01
IGL00323:Stab1	APN	14	31139306	missense	probably benign	0.04
IGL00515:Stab1	APN	14	31159729	missense	probably benign	0.20
IGL00844:Stab1	APN	14	31147066	missense	probably damaging	1.00
IGL01374:Stab1	APN	14	31147075	missense	probably damaging	1.00
IGL01384:Stab1	APN	14	31150408	missense	probably benign
IGL01431:Stab1	APN	14	31148995	missense	probably benign	0.06
IGL01787:Stab1	APN	14	31139808	missense	probably damaging	1.00
IGL02128:Stab1	APN	14	31150441	missense	probably damaging	1.00
IGL02138:Stab1	APN	14	31143513	critical splice donor site	probably null
IGL02256:Stab1	APN	14	31141592	missense	probably damaging	1.00
IGL02340:Stab1	APN	14	31140410	missense	probably damaging	0.96
IGL02507:Stab1	APN	14	31139210	unclassified	probably benign
IGL02695:Stab1	APN	14	31159271	missense	probably damaging	1.00
IGL02755:Stab1	APN	14	31139638	missense	probably benign	0.01
IGL02870:Stab1	APN	14	31139397	missense	probably benign	0.00
IGL02884:Stab1	APN	14	31150143	splice site	probably null
IGL03035:Stab1	APN	14	31147769	missense	probably benign	0.00
IGL03267:Stab1	APN	14	31142729	missense	probably damaging	1.00
IGL03286:Stab1	APN	14	31159326	splice site	probably benign
IGL03366:Stab1	APN	14	31150263	missense	possibly damaging	0.58
IGL03412:Stab1	APN	14	31154407	missense	probably benign	0.42
R0906_Stab1_335	UTSW	14	31145249	missense	probably benign	0.19
R5086_Stab1_467	UTSW	14	31159304	missense	probably damaging	1.00
IGL02835:Stab1	UTSW	14	31146024	critical splice donor site	probably null
K7371:Stab1	UTSW	14	31150249	missense	probably damaging	1.00
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0363:Stab1	UTSW	14	31159008	splice site	probably benign
R0387:Stab1	UTSW	14	31148101	missense	probably benign	0.00
R0391:Stab1	UTSW	14	31143418	missense	probably benign	0.21
R0513:Stab1	UTSW	14	31148945	missense	probably benign	0.08
R0546:Stab1	UTSW	14	31139550	missense	possibly damaging	0.92
R0825:Stab1	UTSW	14	31152600	missense	probably benign	0.16
R0906:Stab1	UTSW	14	31145249	missense	probably benign	0.19
R0963:Stab1	UTSW	14	31147274	missense	probably damaging	0.97
R1219:Stab1	UTSW	14	31140621	splice site	probably null
R1234:Stab1	UTSW	14	31150236	missense	probably damaging	1.00
R1260:Stab1	UTSW	14	31151889	missense	probably damaging	1.00
R1400:Stab1	UTSW	14	31139830	missense	possibly damaging	0.92
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1440:Stab1	UTSW	14	31151690	nonsense	probably null
R1472:Stab1	UTSW	14	31141586	missense	probably benign	0.01
R1474:Stab1	UTSW	14	31149861	missense	probably benign	0.45
R1475:Stab1	UTSW	14	31163828	missense	probably benign
R1509:Stab1	UTSW	14	31151584	splice site	probably benign
R1551:Stab1	UTSW	14	31160499	missense	probably benign	0.00
R1572:Stab1	UTSW	14	31150823	missense	probably damaging	1.00
R1633:Stab1	UTSW	14	31150380	splice site	probably null
R1719:Stab1	UTSW	14	31146028	nonsense	probably null
R1733:Stab1	UTSW	14	31145303	missense	probably damaging	1.00
R1763:Stab1	UTSW	14	31168416	missense	probably benign	0.04
R1808:Stab1	UTSW	14	31141144	missense	possibly damaging	0.80
R1816:Stab1	UTSW	14	31157465	missense	probably benign	0.03
R1853:Stab1	UTSW	14	31140463	missense	probably damaging	1.00
R1891:Stab1	UTSW	14	31141330	missense	probably benign	0.07
R1984:Stab1	UTSW	14	31150648	missense	probably benign	0.20
R1998:Stab1	UTSW	14	31162153	nonsense	probably null
R2165:Stab1	UTSW	14	31168435	missense	probably benign	0.20
R2191:Stab1	UTSW	14	31142800	missense	probably benign	0.03
R2191:Stab1	UTSW	14	31159270	missense	probably damaging	1.00
R2233:Stab1	UTSW	14	31161880	missense	probably benign	0.08
R2303:Stab1	UTSW	14	31146070	missense	probably damaging	1.00
R2496:Stab1	UTSW	14	31161463	missense	probably damaging	1.00
R2504:Stab1	UTSW	14	31163040	critical splice donor site	probably null
R2519:Stab1	UTSW	14	31154872	missense	probably damaging	1.00
R2926:Stab1	UTSW	14	31161799	missense	probably damaging	1.00
R4025:Stab1	UTSW	14	31154952	missense	possibly damaging	0.46
R4113:Stab1	UTSW	14	31168479	missense	probably damaging	0.98
R4258:Stab1	UTSW	14	31154672	missense	possibly damaging	0.92
R4588:Stab1	UTSW	14	31157445	missense	probably benign	0.01
R4644:Stab1	UTSW	14	31140487	unclassified	probably benign
R4660:Stab1	UTSW	14	31154915	missense	possibly damaging	0.91
R4801:Stab1	UTSW	14	31141371	nonsense	probably null
R4802:Stab1	UTSW	14	31141371	nonsense	probably null
R4872:Stab1	UTSW	14	31140393	missense	probably damaging	1.00
R4881:Stab1	UTSW	14	31143672	missense	probably benign	0.32
R4941:Stab1	UTSW	14	31151571	missense	probably benign	0.00
R5061:Stab1	UTSW	14	31163099	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31143624	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5087:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5092:Stab1	UTSW	14	31145855	missense	probably benign	0.01
R5102:Stab1	UTSW	14	31148017	critical splice donor site	probably null
R5107:Stab1	UTSW	14	31163795	splice site	probably null
R5195:Stab1	UTSW	14	31140521	unclassified	probably benign
R5217:Stab1	UTSW	14	31159519	missense	probably benign	0.25
R5285:Stab1	UTSW	14	31143476	unclassified	probably benign
R5327:Stab1	UTSW	14	31161836	nonsense	probably null
R5647:Stab1	UTSW	14	31157440	nonsense	probably null
R5696:Stab1	UTSW	14	31160221	missense	probably benign
R5996:Stab1	UTSW	14	31139551	missense	probably benign	0.39
R6016:Stab1	UTSW	14	31158993	missense	probably damaging	1.00
R6017:Stab1	UTSW	14	31141544	missense	probably benign	0.00
R6174:Stab1	UTSW	14	31162519	nonsense	probably null
R6366:Stab1	UTSW	14	31141438	missense	probably benign	0.10
R6754:Stab1	UTSW	14	31141081	missense	probably benign
R6788:Stab1	UTSW	14	31139160	missense	probably damaging	1.00
R6898:Stab1	UTSW	14	31158963	missense	probably benign	0.00
R7124:Stab1	UTSW	14	31160867	missense	possibly damaging	0.94
R7145:Stab1	UTSW	14	31145073	critical splice donor site	probably null
R7153:Stab1	UTSW	14	31160584	missense	probably benign	0.16
R7213:Stab1	UTSW	14	31143673	missense	probably benign
R7215:Stab1	UTSW	14	31160797	missense	possibly damaging	0.93
R7319:Stab1	UTSW	14	31140826	missense	probably damaging	1.00
R7389:Stab1	UTSW	14	31147239	missense	probably benign	0.00
R7400:Stab1	UTSW	14	31157384	missense	probably null	1.00
R7427:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7428:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7484:Stab1	UTSW	14	31160317	missense	probably benign	0.00
R7568:Stab1	UTSW	14	31152595	missense	probably damaging	1.00
R7574:Stab1	UTSW	14	31154665	missense	probably benign
R7619:Stab1	UTSW	14	31145237	missense	probably benign
R7623:Stab1	UTSW	14	31140621	missense	probably benign	0.03
R7721:Stab1	UTSW	14	31141456	missense	possibly damaging	0.48
R7869:Stab1	UTSW	14	31154472	missense	probably benign	0.01
R7936:Stab1	UTSW	14	31157415	missense	possibly damaging	0.88
R7956:Stab1	UTSW	14	31160024	missense	probably benign	0.02
R7973:Stab1	UTSW	14	31159633	critical splice donor site	probably null
R8059:Stab1	UTSW	14	31160241	missense	probably benign	0.02
R8116:Stab1	UTSW	14	31158953	missense	possibly damaging	0.80
R8304:Stab1	UTSW	14	31148954	missense	probably benign	0.14
R8368:Stab1	UTSW	14	31148411	missense	possibly damaging	0.91
R8495:Stab1	UTSW	14	31155833	missense	probably damaging	1.00
R8513:Stab1	UTSW	14	31149790	critical splice donor site	probably null
R8544:Stab1	UTSW	14	31163051	nonsense	probably null
R8671:Stab1	UTSW	14	31157408	missense	probably damaging	1.00
R8885:Stab1	UTSW	14	31161814	missense	possibly damaging	0.79
R8974:Stab1	UTSW	14	31160822	missense	probably benign
R9022:Stab1	UTSW	14	31160269	missense	probably benign	0.01
R9059:Stab1	UTSW	14	31154848	missense	probably benign	0.01
R9226:Stab1	UTSW	14	31145855	missense	probably benign	0.00
R9272:Stab1	UTSW	14	31145341	missense	probably benign	0.05
R9388:Stab1	UTSW	14	31154355	missense	probably damaging	1.00
R9401:Stab1	UTSW	14	31161112	missense	probably benign
R9433:Stab1	UTSW	14	31143574	missense	probably benign	0.00
R9450:Stab1	UTSW	14	31162939	missense	possibly damaging	0.62
R9505:Stab1	UTSW	14	31155765	missense	probably damaging	1.00
R9570:Stab1	UTSW	14	31142681	missense	probably benign	0.01
R9624:Stab1	UTSW	14	31141388	missense
R9694:Stab1	UTSW	14	31154944	missense	probably benign	0.06
R9723:Stab1	UTSW	14	31163891	missense	probably benign	0.10
X0026:Stab1	UTSW	14	31162191	missense	possibly damaging	0.91
Z1176:Stab1	UTSW	14	31142038	missense	probably benign	0.00
Z1176:Stab1	UTSW	14	31150660	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTTCATCACAACGGCCATG -3'
(R):5'- GGACATGAGTGGACTGATACTC -3'

Sequencing Primer
(F):5'- AACGGCCATGTTGGGTAC -3'
(R):5'- ACTGATACTCCTTGGAGAGCC -3'

Posted On

2016-03-17