Incidental Mutation 'R4870:Tssk4'
ID376524
Institutional Source Beutler Lab
Gene Symbol Tssk4
Ensembl Gene ENSMUSG00000007591
Gene Nametestis-specific serine kinase 4
Synonyms1700020B19Rik, 4933424F08Rik
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55650184-55652539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55651815 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 256 (T256I)
Ref Sequence ENSEMBL: ENSMUSP00000154143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007735] [ENSMUST00000164809] [ENSMUST00000226497] [ENSMUST00000226591] [ENSMUST00000227297] [ENSMUST00000228041] [ENSMUST00000228395]
Predicted Effect probably benign
Transcript: ENSMUST00000007735
AA Change: T266I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000007735
Gene: ENSMUSG00000007591
AA Change: T266I

DomainStartEndE-ValueType
Pfam:Pkinase 25 280 1.1e-54 PFAM
Pfam:Pkinase_Tyr 25 280 7.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164809
AA Change: T266I

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127728
Gene: ENSMUSG00000007591
AA Change: T266I

DomainStartEndE-ValueType
Pfam:Pkinase 25 281 4e-56 PFAM
Pfam:Pkinase_Tyr 25 281 3.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226497
AA Change: T262I

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000226591
AA Change: T256I

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000227297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227568
Predicted Effect probably benign
Transcript: ENSMUST00000228041
AA Change: T256I

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000228395
AA Change: T266I

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0923 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the testis-specific serine/threonine kinase family. The encoded protein is thought to be involved in spermatogenesis via stimulation of the CREB/CRE responsive pathway through phosphorylation of the cAMP responsive element binding protein transcription factor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Tssk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Tssk4 APN 14 55650553 missense probably damaging 1.00
IGL02943:Tssk4 APN 14 55651566 missense probably damaging 1.00
IGL03082:Tssk4 APN 14 55651061 missense probably damaging 1.00
IGL03281:Tssk4 APN 14 55650428 missense possibly damaging 0.86
R0201:Tssk4 UTSW 14 55651559 nonsense probably null
R0201:Tssk4 UTSW 14 55651560 missense probably damaging 1.00
R1655:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R1660:Tssk4 UTSW 14 55650572 missense probably null 0.90
R1743:Tssk4 UTSW 14 55651031 missense probably damaging 1.00
R2103:Tssk4 UTSW 14 55651540 missense probably damaging 1.00
R3431:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R3432:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R4113:Tssk4 UTSW 14 55650373 missense probably benign 0.00
R4957:Tssk4 UTSW 14 55651809 missense probably damaging 1.00
R5147:Tssk4 UTSW 14 55650973 missense possibly damaging 0.56
R6785:Tssk4 UTSW 14 55650475 missense probably damaging 1.00
R6917:Tssk4 UTSW 14 55652407 missense probably benign 0.13
R7748:Tssk4 UTSW 14 55651112 missense probably damaging 1.00
Z1088:Tssk4 UTSW 14 55650923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTTCTTACCGCCAAATG -3'
(R):5'- ACTTTGAGTAGGAGCTCTGGC -3'

Sequencing Primer
(F):5'- CAGACCTACTGTGGCAGCTTTG -3'
(R):5'- GCTCTGGCATGACAAAAGC -3'
Posted On2016-03-17