Incidental Mutation 'R4870:Dip2b'
ID 376527
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 042480-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.636) question?
Stock # R4870 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 100093665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably null
Transcript: ENSMUST00000023768
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100203
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108971
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230619
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,069,540 (GRCm39) I1285N probably damaging Het
Abcc8 G A 7: 45,756,683 (GRCm39) R721* probably null Het
Alox8 T C 11: 69,077,394 (GRCm39) Y423C probably damaging Het
Ankle2 T A 5: 110,399,344 (GRCm39) probably null Het
Cdc14a A G 3: 116,217,109 (GRCm39) I9T probably benign Het
Ceacam18 T C 7: 43,291,328 (GRCm39) C257R probably damaging Het
Cilp T C 9: 65,186,980 (GRCm39) V1025A probably damaging Het
Clcn7 G T 17: 25,372,539 (GRCm39) probably benign Het
Csnk1d A T 11: 120,874,014 (GRCm39) probably benign Het
Cyp11b2 A G 15: 74,724,995 (GRCm39) S285P probably benign Het
Dmrt1 T A 19: 25,483,219 (GRCm39) M1K probably null Het
Dnajc14 T C 10: 128,653,219 (GRCm39) V684A probably benign Het
Dnmt3b A G 2: 153,512,284 (GRCm39) Q335R probably benign Het
Exoc3l2 T A 7: 19,229,117 (GRCm39) C772S unknown Het
F2rl1 A T 13: 95,650,492 (GRCm39) F130Y probably damaging Het
Galk2 C G 2: 125,771,557 (GRCm39) S194* probably null Het
Garre1 C A 7: 33,984,312 (GRCm39) V104L possibly damaging Het
Gpbp1l1 A G 4: 116,430,714 (GRCm39) T62A probably benign Het
H2-Q10 A T 17: 35,781,357 (GRCm39) D53V probably damaging Het
H2-T22 T C 17: 36,349,924 (GRCm39) K356R probably benign Het
Insrr G A 3: 87,718,911 (GRCm39) V956M probably damaging Het
Ints7 A G 1: 191,328,443 (GRCm39) T239A probably damaging Het
Isl1 A G 13: 116,444,806 (GRCm39) probably benign Het
Kcng2 A G 18: 80,366,083 (GRCm39) C90R probably benign Het
Kif3c C T 12: 3,451,735 (GRCm39) P171S probably damaging Het
Knl1 A G 2: 118,911,994 (GRCm39) T1704A probably benign Het
Lats1 A G 10: 7,581,549 (GRCm39) Y778C probably damaging Het
Limd2 T C 11: 106,050,215 (GRCm39) M1V probably null Het
Mcm10 A T 2: 5,008,970 (GRCm39) I333N probably damaging Het
Mipep T A 14: 61,040,329 (GRCm39) L283* probably null Het
Mixl1 A G 1: 180,522,237 (GRCm39) S215P probably benign Het
Mmp21 A G 7: 133,280,406 (GRCm39) L188P probably damaging Het
Mob1a T C 6: 83,317,221 (GRCm39) S213P probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Ndufaf6 T C 4: 11,060,917 (GRCm39) T220A probably benign Het
Nr4a3 A T 4: 48,051,651 (GRCm39) Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,103,852 (GRCm39) probably benign Het
Obscn A T 11: 59,027,032 (GRCm39) L57Q probably damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or5d35 T C 2: 87,855,804 (GRCm39) L246P probably damaging Het
Pirb T A 7: 3,715,661 (GRCm39) M839L probably benign Het
Plcl2 A G 17: 50,914,254 (GRCm39) E421G possibly damaging Het
Ppp1r12b T C 1: 134,876,771 (GRCm39) N99S probably benign Het
Ptpro A G 6: 137,354,130 (GRCm39) K169E probably damaging Het
Rita1 T A 5: 120,749,448 (GRCm39) K88N probably damaging Het
Rptn A T 3: 93,303,776 (GRCm39) K370* probably null Het
Simc1 A G 13: 54,687,576 (GRCm39) D115G probably null Het
Stab1 T A 14: 30,864,000 (GRCm39) N136I probably benign Het
Syt4 T A 18: 31,580,409 (GRCm39) probably benign Het
Sytl2 A T 7: 90,038,106 (GRCm39) N522I probably damaging Het
Tax1bp1 A G 6: 52,706,478 (GRCm39) probably benign Het
Tenm2 A T 11: 35,969,396 (GRCm39) D847E probably damaging Het
Th G T 7: 142,447,834 (GRCm39) D321E probably benign Het
Tmem44 A T 16: 30,359,591 (GRCm39) L46Q probably damaging Het
Trp53bp1 A G 2: 121,087,122 (GRCm39) L178P probably damaging Het
Trp63 A G 16: 25,684,968 (GRCm39) *285W probably null Het
Tsen34 T C 7: 3,697,380 (GRCm39) probably benign Het
Tssk4 C T 14: 55,889,272 (GRCm39) T256I probably benign Het
Ttc17 A T 2: 94,196,954 (GRCm39) N464K probably damaging Het
Ttll2 C T 17: 7,618,998 (GRCm39) V310I probably benign Het
Ubn1 A G 16: 4,895,177 (GRCm39) E741G probably damaging Het
Urad T A 5: 147,252,264 (GRCm39) I63F probably damaging Het
Vcan T C 13: 89,852,858 (GRCm39) T701A probably benign Het
Vmn2r58 A G 7: 41,486,639 (GRCm39) V752A possibly damaging Het
Vmn2r69 C A 7: 85,060,793 (GRCm39) V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 (GRCm39) S1376P probably damaging Het
Zfp955a G A 17: 33,460,699 (GRCm39) R478* probably null Het
Znfx1 A C 2: 166,897,189 (GRCm39) F578L probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGCTGTCATCCTGGTAG -3'
(R):5'- AACCTCTGGCAGTGAATGG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- GCAGTGAATGGCAACTGC -3'
Posted On 2016-03-17