Incidental Mutation 'R4870:Ubn1'
ID376528
Institutional Source Beutler Lab
Gene Symbol Ubn1
Ensembl Gene ENSMUSG00000039473
Gene Nameubinuclein 1
Synonyms1110029L11Rik, 2610108L02Rik
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5050057-5086289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5077313 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 741 (E741G)
Ref Sequence ENSEMBL: ENSMUSP00000155223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052449] [ENSMUST00000229126] [ENSMUST00000230703]
Predicted Effect probably damaging
Transcript: ENSMUST00000052449
AA Change: E741G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061843
Gene: ENSMUSG00000039473
AA Change: E741G

DomainStartEndE-ValueType
Pfam:HUN 117 168 1.4e-22 PFAM
low complexity region 181 224 N/A INTRINSIC
low complexity region 232 238 N/A INTRINSIC
low complexity region 250 267 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Pfam:UBN_AB 353 573 2.4e-80 PFAM
low complexity region 792 804 N/A INTRINSIC
low complexity region 856 882 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229126
AA Change: E741G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229386
Predicted Effect probably damaging
Transcript: ENSMUST00000230703
AA Change: E741G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.0988 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cellular senescence is a hallmark of tumor suppression and tissue aging. Senescent cells contain domains of heterochromatin, called senescence-associated heterochromatin foci (SAHF), that repress proliferation-promoting genes. The protein encoded by this gene binds to proliferation-promoting genes and is required for SAHF formation, enhancing methylation of histone H3. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Ubn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ubn1 APN 16 5081914 missense probably benign 0.00
IGL01726:Ubn1 APN 16 5073470 critical splice donor site probably null
IGL01744:Ubn1 APN 16 5072059 missense probably damaging 1.00
IGL01777:Ubn1 APN 16 5072149 missense possibly damaging 0.46
IGL02110:Ubn1 APN 16 5081890 splice site probably benign
IGL02667:Ubn1 APN 16 5062599 missense probably damaging 1.00
IGL03345:Ubn1 APN 16 5081964 missense probably damaging 0.98
R0201:Ubn1 UTSW 16 5064614 missense probably damaging 1.00
R0437:Ubn1 UTSW 16 5072184 critical splice donor site probably benign
R0514:Ubn1 UTSW 16 5073071 missense probably damaging 1.00
R0550:Ubn1 UTSW 16 5062620 splice site probably null
R0919:Ubn1 UTSW 16 5064391 missense probably damaging 1.00
R1183:Ubn1 UTSW 16 5064542 missense probably damaging 1.00
R1339:Ubn1 UTSW 16 5055335 missense probably damaging 0.99
R1440:Ubn1 UTSW 16 5077294 missense probably damaging 1.00
R1836:Ubn1 UTSW 16 5077391 missense probably benign
R2024:Ubn1 UTSW 16 5064623 missense probably damaging 1.00
R2026:Ubn1 UTSW 16 5064650 missense probably damaging 1.00
R2105:Ubn1 UTSW 16 5077224 nonsense probably null
R2896:Ubn1 UTSW 16 5055219 missense possibly damaging 0.60
R3418:Ubn1 UTSW 16 5074379 splice site probably benign
R3721:Ubn1 UTSW 16 5073378 missense possibly damaging 0.59
R4033:Ubn1 UTSW 16 5064611 missense probably damaging 1.00
R4398:Ubn1 UTSW 16 5064425 missense probably damaging 0.99
R4547:Ubn1 UTSW 16 5072092 missense probably damaging 1.00
R4646:Ubn1 UTSW 16 5077987 missense probably damaging 0.99
R5018:Ubn1 UTSW 16 5063725 missense probably damaging 1.00
R5220:Ubn1 UTSW 16 5077954 missense probably benign 0.02
R5394:Ubn1 UTSW 16 5074369 missense possibly damaging 0.51
R6217:Ubn1 UTSW 16 5077232 missense probably damaging 1.00
R6372:Ubn1 UTSW 16 5081638 missense possibly damaging 0.84
R6418:Ubn1 UTSW 16 5081927 missense probably benign
R6823:Ubn1 UTSW 16 5064547 missense probably damaging 1.00
R7028:Ubn1 UTSW 16 5055324 missense probably damaging 1.00
R7203:Ubn1 UTSW 16 5077216 missense possibly damaging 0.57
R7498:Ubn1 UTSW 16 5077105 missense probably damaging 0.99
R7596:Ubn1 UTSW 16 5081558 missense probably benign 0.25
R8383:Ubn1 UTSW 16 5077358 missense possibly damaging 0.95
R8514:Ubn1 UTSW 16 5073399 missense probably damaging 1.00
RF018:Ubn1 UTSW 16 5064392 missense probably damaging 1.00
X0067:Ubn1 UTSW 16 5055338 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGCTACGTTGAACAGCAGAG -3'
(R):5'- CTGTTGAGTGCCTGCATGAAAG -3'

Sequencing Primer
(F):5'- CGTTGAACAGCAGAGCAGCC -3'
(R):5'- GTGCCTGCATGAAAGACTTTGAC -3'
Posted On2016-03-17