Incidental Mutation 'R0282:Afap1l2'
Institutional Source Beutler Lab
Gene Symbol Afap1l2
Ensembl Gene ENSMUSG00000025083
Gene Nameactin filament associated protein 1-like 2
MMRRC Submission 038504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0282 (G1)
Quality Score225
Status Validated
Chromosomal Location56912361-57008228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56916221 bp
Amino Acid Change Serine to Proline at position 549 (S549P)
Ref Sequence ENSEMBL: ENSMUSP00000112387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068] [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359]
Predicted Effect probably benign
Transcript: ENSMUST00000026068
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082

signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111584
AA Change: S623P

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083
AA Change: S623P

Blast:PH 30 153 3e-60 BLAST
low complexity region 160 170 N/A INTRINSIC
PH 194 291 9.27e-9 SMART
PH 372 467 3.11e-10 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
coiled coil region 675 772 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118800
AA Change: S605P

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083
AA Change: S605P

Blast:PH 12 135 3e-60 BLAST
low complexity region 142 152 N/A INTRINSIC
PH 176 273 9.27e-9 SMART
PH 354 449 3.11e-10 SMART
low complexity region 513 525 N/A INTRINSIC
low complexity region 593 608 N/A INTRINSIC
coiled coil region 657 754 N/A INTRINSIC
low complexity region 773 786 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122359
AA Change: S549P

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083
AA Change: S549P

Blast:PH 1 79 3e-32 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
PH 298 393 3.11e-10 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 537 552 N/A INTRINSIC
coiled coil region 601 698 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155467
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
1700123L14Rik T C 6: 96,164,816 T416A probably benign Het
Alcam A T 16: 52,295,741 C157S probably damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Ano8 G A 8: 71,480,614 probably benign Het
Atr T C 9: 95,862,798 V56A probably benign Het
Aurkc T A 7: 7,002,428 probably null Het
Bnip3 T C 7: 138,898,030 D76G probably damaging Het
Cbr1 A G 16: 93,610,134 E246G possibly damaging Het
Ccdc157 G T 11: 4,146,708 A449D probably damaging Het
Ces3b T A 8: 105,083,851 V26D probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crk G T 11: 75,703,369 G261C probably damaging Het
Ctbp1 A G 5: 33,250,856 probably null Het
Ctnna1 G A 18: 35,244,122 V572I possibly damaging Het
D430041D05Rik T C 2: 104,201,244 Y1669C probably damaging Het
Dnah8 T C 17: 30,736,156 F2053S probably damaging Het
Dner G A 1: 84,405,965 T566M probably damaging Het
Dner A G 1: 84,445,380 probably benign Het
Edrf1 T C 7: 133,644,022 V223A probably benign Het
Fam169a A G 13: 97,097,715 probably benign Het
Fbxl3 G A 14: 103,095,225 H106Y probably damaging Het
Fiz1 A G 7: 5,009,201 V106A probably benign Het
Gapvd1 T A 2: 34,688,960 R654* probably null Het
Gm7589 G A 9: 59,146,005 noncoding transcript Het
Ifi202b A T 1: 173,977,360 S9T probably benign Het
Ipmk G C 10: 71,372,831 S149T probably benign Het
Irgm2 A G 11: 58,219,519 E24G probably benign Het
Itga2b A C 11: 102,460,846 V551G probably damaging Het
Itgad C T 7: 128,189,978 probably benign Het
Kcnh8 T A 17: 52,725,851 F55L probably damaging Het
Kdr G A 5: 75,950,100 probably benign Het
Krt35 T C 11: 100,095,747 Y147C probably damaging Het
Lamc1 A G 1: 153,255,312 F298L probably benign Het
Lrrk2 T C 15: 91,778,414 probably benign Het
Matn1 T C 4: 130,945,927 S69P probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Msto1 A G 3: 88,911,577 V257A possibly damaging Het
Mybpc3 G C 2: 91,124,024 probably benign Het
Mycn A G 12: 12,937,313 V361A probably benign Het
Myo10 A G 15: 25,793,167 T1277A probably damaging Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Olfr1199 G A 2: 88,756,456 T73I probably damaging Het
Olfr1510 A G 14: 52,410,263 V203A possibly damaging Het
Olfr267 A G 4: 58,785,344 I126T probably damaging Het
Olfr504 T A 7: 108,565,477 Q106L probably damaging Het
Otog C T 7: 46,277,493 T1222I possibly damaging Het
P4ha1 C T 10: 59,337,148 T23M probably damaging Het
Pld1 A T 3: 28,078,273 I537F probably benign Het
Plekhn1 A G 4: 156,228,323 probably benign Het
Pxdn C A 12: 29,984,440 S8* probably null Het
Rnf135 A T 11: 80,193,958 I186F probably damaging Het
Rock2 T C 12: 16,977,886 probably benign Het
Rph3a C A 5: 120,963,910 G88* probably null Het
Sarm1 G A 11: 78,474,980 Q740* probably null Het
Setd1b C A 5: 123,161,017 probably benign Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Slc2a4 A T 11: 69,946,355 V85E probably damaging Het
Swi5 A G 2: 32,280,754 Y54H probably damaging Het
Sycp1 A G 3: 102,915,795 probably benign Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tmem67 G A 4: 12,087,930 T72M probably damaging Het
Tor1a A G 2: 30,967,725 Y44H possibly damaging Het
Ttll5 T C 12: 85,996,053 Y1128H probably benign Het
Usp40 G A 1: 87,980,958 probably benign Het
Vmn2r18 A T 5: 151,585,203 M152K probably benign Het
Xirp2 T A 2: 67,513,380 D1988E probably damaging Het
Zfp420 A G 7: 29,875,680 I442V probably benign Het
Zyx A G 6: 42,356,005 E363G probably damaging Het
Other mutations in Afap1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Afap1l2 APN 19 57002308 splice site probably benign
IGL01012:Afap1l2 APN 19 56930261 missense probably damaging 0.98
IGL01089:Afap1l2 APN 19 56913411 splice site probably null
IGL01150:Afap1l2 APN 19 56930186 missense probably damaging 0.99
IGL02393:Afap1l2 APN 19 56914440 missense probably damaging 1.00
IGL02887:Afap1l2 APN 19 56920563 missense probably damaging 1.00
IGL03060:Afap1l2 APN 19 56914250 nonsense probably null
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0388:Afap1l2 UTSW 19 56917242 splice site probably benign
R0432:Afap1l2 UTSW 19 56917119 splice site probably benign
R0497:Afap1l2 UTSW 19 56930209 missense probably benign 0.27
R0578:Afap1l2 UTSW 19 56915782 missense probably benign 0.04
R0631:Afap1l2 UTSW 19 56916085 missense probably benign 0.39
R0670:Afap1l2 UTSW 19 56915803 missense probably damaging 1.00
R1188:Afap1l2 UTSW 19 56925069 missense probably damaging 0.97
R1236:Afap1l2 UTSW 19 56916472 missense possibly damaging 0.64
R1274:Afap1l2 UTSW 19 56914563 missense probably benign 0.02
R1463:Afap1l2 UTSW 19 56930151 missense probably benign 0.01
R1497:Afap1l2 UTSW 19 56928311 missense probably benign 0.25
R1597:Afap1l2 UTSW 19 56914449 missense probably benign 0.14
R1778:Afap1l2 UTSW 19 56916206 missense possibly damaging 0.68
R1795:Afap1l2 UTSW 19 56928409 missense probably damaging 1.00
R1991:Afap1l2 UTSW 19 57002267 missense possibly damaging 0.62
R2113:Afap1l2 UTSW 19 56913389 missense possibly damaging 0.95
R2242:Afap1l2 UTSW 19 56914468 missense possibly damaging 0.56
R3429:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3430:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3698:Afap1l2 UTSW 19 56916523 missense possibly damaging 0.69
R4706:Afap1l2 UTSW 19 56937240 missense possibly damaging 0.76
R4956:Afap1l2 UTSW 19 56943447 missense probably benign 0.00
R4993:Afap1l2 UTSW 19 56918040 missense probably damaging 1.00
R5772:Afap1l2 UTSW 19 56922974 missense probably benign 0.02
R5878:Afap1l2 UTSW 19 56915675 missense probably benign 0.01
R6194:Afap1l2 UTSW 19 56922951 missense probably damaging 1.00
R6226:Afap1l2 UTSW 19 56916128 missense probably benign 0.00
R6334:Afap1l2 UTSW 19 56917976 splice site probably null
R6439:Afap1l2 UTSW 19 56928386 missense possibly damaging 0.91
R7332:Afap1l2 UTSW 19 56918121 missense probably damaging 1.00
R7524:Afap1l2 UTSW 19 56918111 missense probably damaging 1.00
R7577:Afap1l2 UTSW 19 56944767 missense probably damaging 1.00
R7696:Afap1l2 UTSW 19 56914486 missense probably damaging 1.00
R7741:Afap1l2 UTSW 19 56914482 missense probably damaging 1.00
R7940:Afap1l2 UTSW 19 56914165 missense probably damaging 0.99
R8221:Afap1l2 UTSW 19 56914392 missense probably damaging 1.00
X0062:Afap1l2 UTSW 19 56918033 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgtgaaagaagaggatcggg -3'
Posted On2013-05-23