Incidental Mutation 'R4870:Tmem44'
ID376530
Institutional Source Beutler Lab
Gene Symbol Tmem44
Ensembl Gene ENSMUSG00000022537
Gene Nametransmembrane protein 44
Synonyms9330161C17Rik, 1700007N03Rik
MMRRC Submission 042480-MU
Accession Numbers

Genbank: NM_172614.3; Ensembl: ENSMUST00000140402

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location30511855-30550842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30540773 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 46 (L46Q)
Ref Sequence ENSEMBL: ENSMUSP00000116531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089775] [ENSMUST00000140402] [ENSMUST00000144001] [ENSMUST00000149110]
Predicted Effect probably benign
Transcript: ENSMUST00000089775
SMART Domains Protein: ENSMUSP00000087207
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125559
Predicted Effect probably damaging
Transcript: ENSMUST00000140402
AA Change: L249Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123494
Gene: ENSMUSG00000022537
AA Change: L249Q

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 179 197 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144001
SMART Domains Protein: ENSMUSP00000119318
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144491
Predicted Effect probably damaging
Transcript: ENSMUST00000149110
AA Change: L46Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116531
Gene: ENSMUSG00000022537
AA Change: L46Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
transmembrane domain 44 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
low complexity region 180 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232166
Meta Mutation Damage Score 0.3926 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
Allele List at MGI

All alleles(8) : Targeted, other(3) Gene trapped(5)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Tmem44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Tmem44 APN 16 30539381 splice site probably benign
IGL03308:Tmem44 APN 16 30543748 missense probably damaging 0.97
1mM(1):Tmem44 UTSW 16 30543497 unclassified probably benign
R0452:Tmem44 UTSW 16 30517463 splice site probably benign
R1073:Tmem44 UTSW 16 30514833 splice site probably benign
R1962:Tmem44 UTSW 16 30543401 critical splice donor site probably null
R2118:Tmem44 UTSW 16 30547444 nonsense probably null
R2122:Tmem44 UTSW 16 30547444 nonsense probably null
R2124:Tmem44 UTSW 16 30547444 nonsense probably null
R5328:Tmem44 UTSW 16 30540891 missense possibly damaging 0.83
R6653:Tmem44 UTSW 16 30537551 missense probably damaging 0.97
R6818:Tmem44 UTSW 16 30543221 splice site probably null
R7058:Tmem44 UTSW 16 30547395 missense possibly damaging 0.92
R7738:Tmem44 UTSW 16 30543410 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCTTGTCCCAGGCTTTTAATG -3'
(R):5'- CTTTGTAAGTGGCCGCTCATAG -3'

Sequencing Primer
(F):5'- GTCCCAGGCTTTTAATGACTGGAC -3'
(R):5'- TCATAGAGGGCTTGCCCAATG -3'
Posted On2016-03-17