Incidental Mutation 'R4870:Clcn7'
ID376532
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Namechloride channel, voltage-sensitive 7
SynonymsClC-7
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25133391-25162104 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 25153565 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000160961]
Predicted Effect probably benign
Transcript: ENSMUST00000040729
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159773
SMART Domains Protein: ENSMUSP00000125546
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 76 202 5.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160961
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161153
Predicted Effect unknown
Transcript: ENSMUST00000162862
AA Change: G106V
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636
AA Change: G106V

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R721* probably null Het
Alox8 T C 11: 69,186,568 Y423C probably damaging Het
Ankle2 T A 5: 110,251,478 probably null Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G probably null Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D321E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 probably benign Het
Tssk4 C T 14: 55,651,815 T256I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1376P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25151123 missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25151116 missense probably benign 0.13
IGL01912:Clcn7 APN 17 25153009 splice site probably benign
IGL01936:Clcn7 APN 17 25155376 missense probably benign 0.44
IGL02084:Clcn7 APN 17 25157925 missense probably benign
IGL02121:Clcn7 APN 17 25153084 missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25149030 unclassified probably benign
IGL02335:Clcn7 APN 17 25146847 missense probably benign 0.00
IGL02507:Clcn7 APN 17 25144469 missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25146818 missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25146453 unclassified probably benign
IGL03192:Clcn7 APN 17 25133601 missense probably benign 0.00
IGL03194:Clcn7 APN 17 25150548 missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25155385 missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25153754 missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25149202 unclassified probably benign
R0970:Clcn7 UTSW 17 25151234 critical splice donor site probably null
R1644:Clcn7 UTSW 17 25159698 missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25160471 missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25144451 missense probably benign
R2173:Clcn7 UTSW 17 25145609 missense probably benign
R2401:Clcn7 UTSW 17 25153140 missense probably benign 0.02
R2511:Clcn7 UTSW 17 25155446 missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25159707 missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25160176 missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25157961 missense probably damaging 1.00
R5372:Clcn7 UTSW 17 25157179 missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25149052 missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25157954 missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25151728 missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25157528 missense probably benign 0.01
R6798:Clcn7 UTSW 17 25159760 missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25157214 missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25146351 missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25153693 missense
R7757:Clcn7 UTSW 17 25156822 missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25149259 nonsense probably null
X0020:Clcn7 UTSW 17 25150226 missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25153015 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAAACAAATGATGCGTCCCTC -3'
(R):5'- GCTCTTCTCAGGGGTGTTAAAG -3'

Sequencing Primer
(F):5'- AATGATGCGTCCCTCCATATAG -3'
(R):5'- GTTGTATTCGCCATCTGCACAGAAG -3'
Posted On2016-03-17