Incidental Mutation 'R0295:Oprk1'
ID37654
Institutional Source Beutler Lab
Gene Symbol Oprk1
Ensembl Gene ENSMUSG00000025905
Gene Nameopioid receptor, kappa 1
SynonymsR21, KOR-1, Oprk2
MMRRC Submission 038512-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0295 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location5588466-5606131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5598850 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 173 (L173S)
Ref Sequence ENSEMBL: ENSMUSP00000125105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027038] [ENSMUST00000160339] [ENSMUST00000160777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027038
AA Change: L173S

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027038
Gene: ENSMUSG00000025905
AA Change: L173S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159083
Predicted Effect possibly damaging
Transcript: ENSMUST00000160339
AA Change: L173S

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124030
Gene: ENSMUSG00000025905
AA Change: L173S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 284 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-60 PFAM
Pfam:7TM_GPCR_Srv 78 345 5.2e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160777
AA Change: L173S

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125105
Gene: ENSMUSG00000025905
AA Change: L173S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Meta Mutation Damage Score 0.1201 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired response to morphine and an opioid agonist, abnormal pain threshold, and increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,282,594 I173N probably damaging Het
2610028H24Rik G A 10: 76,454,808 S127N probably damaging Het
Abcc8 T C 7: 46,118,054 R953G probably benign Het
Adamtsl3 T A 7: 82,548,005 probably null Het
Adh4 A G 3: 138,429,076 D337G probably damaging Het
Apob T A 12: 8,002,181 Y1207* probably null Het
Birc6 T C 17: 74,613,362 probably benign Het
Bms1 A G 6: 118,389,337 I1065T probably benign Het
Cacna1i T A 15: 80,356,211 L378Q probably damaging Het
Ccdc127 C A 13: 74,356,870 P179H probably damaging Het
Ccdc18 A T 5: 108,173,789 K586N probably damaging Het
Cep290 A C 10: 100,537,821 E1321A probably damaging Het
Ctc1 A G 11: 69,030,588 K682E possibly damaging Het
Cux1 A C 5: 136,313,212 V442G probably benign Het
Dph2 A T 4: 117,890,930 V150E possibly damaging Het
Etv6 A G 6: 134,266,275 D331G probably benign Het
Fbxo42 A G 4: 141,200,497 D696G probably damaging Het
Fbxo8 G A 8: 56,590,074 D198N probably benign Het
Gria4 T C 9: 4,793,840 T73A possibly damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Ifng G T 10: 118,441,249 S32I possibly damaging Het
Ildr1 A G 16: 36,709,477 probably null Het
Knl1 A C 2: 119,088,839 D1824A probably damaging Het
Lamp3 A T 16: 19,701,108 Y108* probably null Het
Lcp1 A G 14: 75,199,420 I69V probably null Het
Lrp6 A T 6: 134,457,693 V1349E probably benign Het
Lrrcc1 A T 3: 14,565,849 E1009D probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Med14 G C X: 12,685,748 R1223G probably damaging Het
Mesd C T 7: 83,897,865 Q179* probably null Het
Myh7 A G 14: 54,984,821 probably benign Het
Myo6 T C 9: 80,283,579 I804T probably damaging Het
Neb T C 2: 52,284,285 I1521V possibly damaging Het
Nosip T A 7: 45,076,916 I249N probably damaging Het
Nostrin A C 2: 69,179,416 E296A probably benign Het
Olfr1280 T A 2: 111,316,154 V225D probably damaging Het
Olfr136 A T 17: 38,335,291 I45F probably damaging Het
Olfr491 T G 7: 108,317,685 S264A probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Pdzd7 A G 19: 45,037,072 V328A probably benign Het
Podxl2 A T 6: 88,849,678 S215R probably benign Het
Prss36 T G 7: 127,935,855 T418P possibly damaging Het
Ralgps2 T A 1: 156,823,985 probably benign Het
Rasa2 T C 9: 96,545,810 probably null Het
Rgs1 A T 1: 144,245,486 I149N probably damaging Het
Rgs16 A G 1: 153,743,737 E163G probably damaging Het
Rnf121 A G 7: 102,035,346 F120S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slfn8 A T 11: 83,003,343 Y823* probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
St6gal1 T A 16: 23,356,203 probably benign Het
Tet3 G A 6: 83,369,139 P1304S probably benign Het
Timm29 T C 9: 21,593,076 probably null Het
Tpcn1 T A 5: 120,539,060 I687F probably damaging Het
Trim46 A G 3: 89,245,113 probably benign Het
Ttc23 T A 7: 67,669,852 probably benign Het
Ttll6 G T 11: 96,154,714 V586L probably benign Het
Ttn A T 2: 76,758,611 probably benign Het
Uba3 A T 6: 97,191,583 H160Q possibly damaging Het
Usp32 A G 11: 85,053,692 S316P probably damaging Het
Vcan T C 13: 89,712,191 I352M probably benign Het
Zcwpw1 G T 5: 137,817,472 L412F probably damaging Het
Zfp292 A T 4: 34,806,281 N2254K probably damaging Het
Zscan4e A G 7: 11,307,616 S138P probably damaging Het
Other mutations in Oprk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Oprk1 APN 1 5598905 missense probably damaging 0.99
IGL02049:Oprk1 APN 1 5598844 missense probably damaging 1.00
IGL02076:Oprk1 APN 1 5602289 missense probably damaging 1.00
IGL02265:Oprk1 APN 1 5602648 missense probably damaging 1.00
IGL02294:Oprk1 APN 1 5602387 missense probably damaging 1.00
IGL02584:Oprk1 APN 1 5598604 missense probably damaging 1.00
IGL03164:Oprk1 APN 1 5598864 missense probably damaging 1.00
R1209:Oprk1 UTSW 1 5602261 missense probably benign 0.00
R1420:Oprk1 UTSW 1 5602321 missense probably damaging 1.00
R2994:Oprk1 UTSW 1 5602732 missense probably benign 0.00
R3876:Oprk1 UTSW 1 5602661 nonsense probably null
R4026:Oprk1 UTSW 1 5598685 missense probably benign 0.04
R4096:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4097:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4475:Oprk1 UTSW 1 5602601 nonsense probably null
R5177:Oprk1 UTSW 1 5602674 missense probably damaging 1.00
R5223:Oprk1 UTSW 1 5589296 missense probably benign 0.30
R6397:Oprk1 UTSW 1 5598748 missense probably damaging 1.00
R6647:Oprk1 UTSW 1 5602284 missense probably damaging 1.00
R7169:Oprk1 UTSW 1 5589081 missense probably benign
R7170:Oprk1 UTSW 1 5602396 missense probably damaging 1.00
R8186:Oprk1 UTSW 1 5602317 missense probably benign 0.16
Z1176:Oprk1 UTSW 1 5602702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCAGATGCTTTGGTTACTACCAC -3'
(R):5'- TAGGCTCTGGCACTATCATCACCC -3'

Sequencing Primer
(F):5'- ATGCCCTTTCAGAGTGCTG -3'
(R):5'- CACCCTACTCCATGTTTAAAAGTG -3'
Posted On2013-05-23