Incidental Mutation 'R0295:Rgs1'
ID 37655
Institutional Source Beutler Lab
Gene Symbol Rgs1
Ensembl Gene ENSMUSG00000026358
Gene Name regulator of G-protein signaling 1
Synonyms BL34
MMRRC Submission 038512-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R0295 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 144120407-144124862 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144121224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 149 (I149N)
Ref Sequence ENSEMBL: ENSMUSP00000140624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167317] [ENSMUST00000169409] [ENSMUST00000172388] [ENSMUST00000185714] [ENSMUST00000189061]
AlphaFold Q9JL25
Predicted Effect probably benign
Transcript: ENSMUST00000167317
Predicted Effect probably benign
Transcript: ENSMUST00000167812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169042
Predicted Effect probably benign
Transcript: ENSMUST00000169409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170870
Predicted Effect probably benign
Transcript: ENSMUST00000172388
SMART Domains Protein: ENSMUSP00000130339
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185714
AA Change: I122N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140902
Gene: ENSMUSG00000026358
AA Change: I122N

DomainStartEndE-ValueType
RGS 58 128 2.8e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189061
AA Change: I149N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140624
Gene: ENSMUSG00000026358
AA Change: I149N

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189916
Meta Mutation Damage Score 0.8986 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased splenic B cell germinal centers, increased chemotactic responses in B cells and immature dendritic cells, and decreased antibody secreting cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,290,642 (GRCm39) S127N probably damaging Het
Abcc8 T C 7: 45,767,478 (GRCm39) R953G probably benign Het
Adamtsl3 T A 7: 82,197,213 (GRCm39) probably null Het
Adh4 A G 3: 138,134,837 (GRCm39) D337G probably damaging Het
Apob T A 12: 8,052,181 (GRCm39) Y1207* probably null Het
Birc6 T C 17: 74,920,357 (GRCm39) probably benign Het
Bms1 A G 6: 118,366,298 (GRCm39) I1065T probably benign Het
Cacna1i T A 15: 80,240,412 (GRCm39) L378Q probably damaging Het
Ccdc127 C A 13: 74,504,989 (GRCm39) P179H probably damaging Het
Ccdc18 A T 5: 108,321,655 (GRCm39) K586N probably damaging Het
Cep290 A C 10: 100,373,683 (GRCm39) E1321A probably damaging Het
Cstpp1 A T 2: 91,112,939 (GRCm39) I173N probably damaging Het
Ctc1 A G 11: 68,921,414 (GRCm39) K682E possibly damaging Het
Cux1 A C 5: 136,342,066 (GRCm39) V442G probably benign Het
Dph2 A T 4: 117,748,127 (GRCm39) V150E possibly damaging Het
Etv6 A G 6: 134,243,238 (GRCm39) D331G probably benign Het
Fbxo42 A G 4: 140,927,808 (GRCm39) D696G probably damaging Het
Fbxo8 G A 8: 57,043,109 (GRCm39) D198N probably benign Het
Gria4 T C 9: 4,793,840 (GRCm39) T73A possibly damaging Het
H2aj C G 6: 136,785,602 (GRCm39) R89G probably damaging Het
Ifng G T 10: 118,277,154 (GRCm39) S32I possibly damaging Het
Ildr1 A G 16: 36,529,839 (GRCm39) probably null Het
Knl1 A C 2: 118,919,320 (GRCm39) D1824A probably damaging Het
Lamp3 A T 16: 19,519,858 (GRCm39) Y108* probably null Het
Lcp1 A G 14: 75,436,860 (GRCm39) I69V probably null Het
Lrp6 A T 6: 134,434,656 (GRCm39) V1349E probably benign Het
Lrrcc1 A T 3: 14,630,909 (GRCm39) E1009D probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Med14 G C X: 12,551,987 (GRCm39) R1223G probably damaging Het
Mesd C T 7: 83,547,073 (GRCm39) Q179* probably null Het
Myh7 A G 14: 55,222,278 (GRCm39) probably benign Het
Myo6 T C 9: 80,190,861 (GRCm39) I804T probably damaging Het
Neb T C 2: 52,174,297 (GRCm39) I1521V possibly damaging Het
Nosip T A 7: 44,726,340 (GRCm39) I249N probably damaging Het
Nostrin A C 2: 69,009,760 (GRCm39) E296A probably benign Het
Oprk1 T C 1: 5,669,073 (GRCm39) L173S possibly damaging Het
Or2n1d A T 17: 38,646,182 (GRCm39) I45F probably damaging Het
Or4k36 T A 2: 111,146,499 (GRCm39) V225D probably damaging Het
Or51v8 T C 7: 103,319,518 (GRCm39) H240R probably damaging Het
Or5p1 T G 7: 107,916,892 (GRCm39) S264A probably benign Het
Pdzd7 A G 19: 45,025,511 (GRCm39) V328A probably benign Het
Podxl2 A T 6: 88,826,660 (GRCm39) S215R probably benign Het
Prss36 T G 7: 127,535,027 (GRCm39) T418P possibly damaging Het
Ralgps2 T A 1: 156,651,555 (GRCm39) probably benign Het
Rasa2 T C 9: 96,427,863 (GRCm39) probably null Het
Rgs16 A G 1: 153,619,483 (GRCm39) E163G probably damaging Het
Rnf121 A G 7: 101,684,553 (GRCm39) F120S possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slfn8 A T 11: 82,894,169 (GRCm39) Y823* probably null Het
Spdl1 A T 11: 34,704,170 (GRCm39) N554K possibly damaging Het
St6gal1 T A 16: 23,174,953 (GRCm39) probably benign Het
Tet3 G A 6: 83,346,121 (GRCm39) P1304S probably benign Het
Timm29 T C 9: 21,504,372 (GRCm39) probably null Het
Tpcn1 T A 5: 120,677,125 (GRCm39) I687F probably damaging Het
Trim46 A G 3: 89,152,420 (GRCm39) probably benign Het
Ttc23 T A 7: 67,319,600 (GRCm39) probably benign Het
Ttll6 G T 11: 96,045,540 (GRCm39) V586L probably benign Het
Ttn A T 2: 76,588,955 (GRCm39) probably benign Het
Uba3 A T 6: 97,168,544 (GRCm39) H160Q possibly damaging Het
Usp32 A G 11: 84,944,518 (GRCm39) S316P probably damaging Het
Vcan T C 13: 89,860,310 (GRCm39) I352M probably benign Het
Zcwpw1 G T 5: 137,815,734 (GRCm39) L412F probably damaging Het
Zfp292 A T 4: 34,806,281 (GRCm39) N2254K probably damaging Het
Zscan4e A G 7: 11,041,543 (GRCm39) S138P probably damaging Het
Other mutations in Rgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Rgs1 APN 1 144,121,116 (GRCm39) missense probably damaging 1.00
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0149:Rgs1 UTSW 1 144,124,825 (GRCm39) start gained probably benign
R0833:Rgs1 UTSW 1 144,123,671 (GRCm39) missense probably damaging 1.00
R0836:Rgs1 UTSW 1 144,123,671 (GRCm39) missense probably damaging 1.00
R1585:Rgs1 UTSW 1 144,121,227 (GRCm39) critical splice acceptor site probably null
R4373:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4375:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4769:Rgs1 UTSW 1 144,123,667 (GRCm39) missense probably damaging 1.00
R4961:Rgs1 UTSW 1 144,124,309 (GRCm39) splice site probably null
R4992:Rgs1 UTSW 1 144,122,060 (GRCm39) missense probably damaging 1.00
R5427:Rgs1 UTSW 1 144,122,018 (GRCm39) nonsense probably null
R5614:Rgs1 UTSW 1 144,121,995 (GRCm39) missense probably benign 0.18
R5743:Rgs1 UTSW 1 144,121,110 (GRCm39) missense probably damaging 1.00
R7315:Rgs1 UTSW 1 144,124,637 (GRCm39) critical splice donor site probably null
R7491:Rgs1 UTSW 1 144,121,134 (GRCm39) missense probably damaging 1.00
R7633:Rgs1 UTSW 1 144,124,215 (GRCm39) critical splice donor site probably null
R9640:Rgs1 UTSW 1 144,121,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGTCAGCCAGGAATCACTCAC -3'
(R):5'- GCAGGGCAGATTGTATGTTAAGGAACC -3'

Sequencing Primer
(F):5'- TCAGGAACCTGGGATAAGAATC -3'
(R):5'- ACAGTGTTGATCTTCCAGGAC -3'
Posted On 2013-05-23