Incidental Mutation 'R4871:Hnf4g'
ID376558
Institutional Source Beutler Lab
Gene Symbol Hnf4g
Ensembl Gene ENSMUSG00000017688
Gene Namehepatocyte nuclear factor 4, gamma
SynonymsNR2A2
MMRRC Submission 042481-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R4871 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location3508030-3658052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3651388 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 291 (Y291H)
Ref Sequence ENSEMBL: ENSMUSP00000104031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108393] [ENSMUST00000108394]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108393
AA Change: Y247H

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104030
Gene: ENSMUSG00000017688
AA Change: Y247H

DomainStartEndE-ValueType
ZnF_C4 9 80 6.51e-35 SMART
low complexity region 118 125 N/A INTRINSIC
HOLI 141 299 7.29e-47 SMART
low complexity region 334 345 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108394
AA Change: Y291H

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104031
Gene: ENSMUSG00000017688
AA Change: Y291H

DomainStartEndE-ValueType
ZnF_C4 63 134 6.51e-35 SMART
low complexity region 172 179 N/A INTRINSIC
HOLI 195 353 7.29e-47 SMART
low complexity region 388 399 N/A INTRINSIC
Meta Mutation Damage Score 0.6989 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 93% (99/107)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are less inclined to build nests, spend more time in a passive state during the forced swim test, and display a reduction in energy expenditure and night time activity that results in increased body weight despite adecreased intake of food and water. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,480,093 T270A probably null Het
Adgrv1 A T 13: 81,533,122 probably benign Het
Aldh1b1 A T 4: 45,803,383 D307V probably benign Het
Aldh3a2 A T 11: 61,262,239 C220* probably null Het
Ank2 T C 3: 126,959,795 Y279C probably damaging Het
Anks1 T C 17: 27,991,377 Y444H probably benign Het
Asph G T 4: 9,531,968 T383K probably benign Het
Asphd1 G T 7: 126,948,575 S185R possibly damaging Het
Bcl2a1d T A 9: 88,731,695 I9F probably damaging Het
Bcl2l11 T C 2: 128,129,041 probably benign Het
C2cd3 T G 7: 100,413,374 S656A possibly damaging Het
Ccdc109b C T 3: 129,917,036 W249* probably null Het
Cd5l T C 3: 87,367,622 V156A probably damaging Het
Cdh8 G C 8: 99,030,904 N687K probably damaging Het
Cdk19 A G 10: 40,476,236 D338G probably benign Het
Cenpf A G 1: 189,658,531 C1035R probably damaging Het
Cep290 A G 10: 100,548,914 R1845G probably benign Het
Cep295nl G T 11: 118,333,824 Q65K probably damaging Het
Ciz1 T C 2: 32,372,288 probably benign Het
Clasrp T C 7: 19,590,248 D234G possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Ddr2 A G 1: 170,004,771 V150A probably benign Het
Dnah7b T C 1: 46,081,444 S74P probably benign Het
Dnttip2 C A 3: 122,285,101 A743E probably damaging Het
Dysf A T 6: 84,067,023 Q281L possibly damaging Het
Ece2 A G 16: 20,644,155 E610G probably damaging Het
Edem3 T G 1: 151,804,231 probably null Het
Ext1 G T 15: 53,092,377 N441K probably benign Het
Fam118a A G 15: 85,058,768 R333G probably damaging Het
Fam45a A G 19: 60,830,814 E120G probably damaging Het
Fat4 C T 3: 38,891,605 T1549I probably damaging Het
Fbxo4 A G 15: 3,975,912 V162A probably damaging Het
Fgd2 A G 17: 29,373,249 H385R possibly damaging Het
Garnl3 A T 2: 33,087,088 M1K probably null Het
Gm37267 T G 1: 180,510,518 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbar1 C T 1: 74,279,543 A315V probably damaging Het
Grm2 T C 9: 106,647,645 I624V probably benign Het
Hmcn1 T C 1: 150,593,085 I5042V probably benign Het
Ighm A G 12: 113,421,621 S240P unknown Het
Igkv4-91 A G 6: 68,768,620 I98T probably damaging Het
Krt72 T C 15: 101,786,034 N142S probably damaging Het
Kynu T A 2: 43,679,818 Y371N possibly damaging Het
Ly9 G T 1: 171,607,330 probably benign Het
Man1a2 C A 3: 100,617,056 V359F probably damaging Het
Mast1 T C 8: 84,920,658 I623M probably damaging Het
Mb A G 15: 77,022,487 probably null Het
Mcm4 A C 16: 15,634,510 L113* probably null Het
Mme T A 3: 63,340,032 V246E probably benign Het
Mrpl38 A G 11: 116,134,272 Y232H probably damaging Het
Myh7b T A 2: 155,613,500 M89K probably benign Het
Notch4 A G 17: 34,577,562 S892G possibly damaging Het
Nt5dc3 A G 10: 86,817,077 Y245C probably damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr101 T A 17: 37,300,204 T73S probably benign Het
Olfr1024 T A 2: 85,904,371 I228F probably benign Het
Olfr104-ps A T 17: 37,362,446 I107L probably benign Het
Olfr1066 A T 2: 86,455,809 I154N possibly damaging Het
Olfr305 A T 7: 86,363,484 N284K probably damaging Het
Olfr883 G T 9: 38,026,526 C240F probably damaging Het
Palld A T 8: 61,549,781 probably benign Het
Pcdhga10 T C 18: 37,748,200 V338A probably damaging Het
Pcdhga11 A G 18: 37,757,406 Y489C probably damaging Het
Pgm1 T C 5: 64,103,894 Y244H probably benign Het
Phactr4 A T 4: 132,378,448 S102R probably damaging Het
Plekha5 A G 6: 140,525,910 Y20C probably damaging Het
Rdh19 A G 10: 127,860,144 D255G probably benign Het
Rgs3 T C 4: 62,631,295 V438A probably benign Het
Rnf186 A G 4: 138,967,943 T265A probably benign Het
Ror1 T C 4: 100,425,998 F420S probably benign Het
Rtkn2 A G 10: 68,005,633 K204E probably damaging Het
Rundc1 A G 11: 101,434,048 T527A probably benign Het
Samd4 T C 14: 47,066,463 S301P probably damaging Het
Scaf1 G A 7: 45,005,879 probably benign Het
Srgap2 A G 1: 131,289,472 V1034A probably benign Het
Stab2 T C 10: 86,942,235 D743G probably damaging Het
Stim1 A T 7: 102,354,572 I71F probably damaging Het
Stk17b T C 1: 53,757,534 D358G probably benign Het
Sun2 A G 15: 79,727,564 Y551H probably damaging Het
Tas2r110 A T 6: 132,868,128 T41S probably benign Het
Tead3 T A 17: 28,333,615 E268V probably damaging Het
Tead3 A G 17: 28,334,988 S131P probably benign Het
Tepsin A T 11: 120,091,525 M505K possibly damaging Het
Trbv29 A G 6: 41,271,734 Y66C possibly damaging Het
Ttc6 A G 12: 57,702,356 Q1358R probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Uaca T C 9: 60,846,001 V76A probably damaging Het
Vwf A T 6: 125,686,462 T2789S probably benign Het
Yipf4 T C 17: 74,494,094 F136L probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp804b A T 5: 6,876,479 D51E probably damaging Het
Zfyve9 C T 4: 108,680,986 G969R probably damaging Het
Other mutations in Hnf4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hnf4g APN 3 3648082 missense probably benign
IGL00832:Hnf4g APN 3 3641276 missense probably damaging 1.00
IGL01571:Hnf4g APN 3 3651266 splice site probably benign
IGL01896:Hnf4g APN 3 3651410 missense probably damaging 1.00
IGL02068:Hnf4g APN 3 3644576 missense probably benign
IGL03040:Hnf4g APN 3 3634211 utr 5 prime probably benign
IGL03097:Hnf4g UTSW 3 3651614 missense probably damaging 1.00
R0124:Hnf4g UTSW 3 3643082 splice site probably benign
R0477:Hnf4g UTSW 3 3651791 splice site probably benign
R0512:Hnf4g UTSW 3 3651622 missense probably damaging 1.00
R0744:Hnf4g UTSW 3 3651629 missense possibly damaging 0.92
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1656:Hnf4g UTSW 3 3652951 missense probably benign
R1982:Hnf4g UTSW 3 3638208 missense probably damaging 0.99
R2336:Hnf4g UTSW 3 3641224 missense probably benign 0.25
R3104:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3105:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3106:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3843:Hnf4g UTSW 3 3651302 missense probably benign 0.09
R4200:Hnf4g UTSW 3 3651284 missense possibly damaging 0.94
R4248:Hnf4g UTSW 3 3652849 missense possibly damaging 0.69
R4418:Hnf4g UTSW 3 3648094 missense possibly damaging 0.66
R4756:Hnf4g UTSW 3 3643009 missense possibly damaging 0.69
R5022:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5023:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5088:Hnf4g UTSW 3 3657121 missense probably benign 0.09
R5604:Hnf4g UTSW 3 3657126 nonsense probably null
R6746:Hnf4g UTSW 3 3657110 nonsense probably null
R7088:Hnf4g UTSW 3 3648125 splice site probably null
R7335:Hnf4g UTSW 3 3652864 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTTGTACCTGACACAGAGCCC -3'
(R):5'- TCCCTTTGCATCTGATGAGG -3'

Sequencing Primer
(F):5'- GAAGAGACCATTTTGAACACTGC -3'
(R):5'- CCTTTGCATCTGATGAGGGAAGAAAC -3'
Posted On2016-03-17