Incidental Mutation 'R4871:Ank2'
ID 376563
Institutional Source Beutler Lab
Gene Symbol Ank2
Ensembl Gene ENSMUSG00000032826
Gene Name ankyrin 2, brain
Synonyms Gm4392, Ank-2, ankyrin B, Ankyrin-B, Ankyrin-2
MMRRC Submission 042481-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4871 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 126715261-127292999 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 126753444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 279 (Y279C)
Ref Sequence ENSEMBL: ENSMUSP00000043765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182078] [ENSMUST00000182711] [ENSMUST00000182959]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044443
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826
AA Change: Y279C

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
ZU5 128 232 4.13e-61 SMART
Pfam:ZU5 289 374 2.8e-8 PFAM
low complexity region 587 597 N/A INTRINSIC
DEATH 603 697 1.52e-27 SMART
low complexity region 732 748 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182025
Predicted Effect probably benign
Transcript: ENSMUST00000182062
Predicted Effect
SMART Domains Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: Y1150C

DomainStartEndE-ValueType
ANK 9 38 1e1 SMART
ANK 42 71 8.9e-7 SMART
ANK 75 104 4.4e-9 SMART
ANK 108 137 2.8e-9 SMART
ANK 141 169 5.3e-1 SMART
ANK 170 199 7.3e-1 SMART
ANK 211 240 1.1e-7 SMART
ANK 244 273 4.4e-9 SMART
ANK 277 306 9.3e-8 SMART
ANK 310 339 2.1e-8 SMART
ANK 343 372 1.3e-7 SMART
ANK 376 405 6.2e-9 SMART
ANK 409 438 1.1e-7 SMART
ANK 442 471 2.9e-8 SMART
ANK 475 504 1.1e-5 SMART
ANK 508 537 6.5e-6 SMART
ANK 541 570 2.3e-7 SMART
ANK 574 603 2.4e-7 SMART
ANK 607 636 3.2e-9 SMART
ANK 640 669 5.5e-5 SMART
ANK 673 702 1.9e-8 SMART
ANK 706 735 3.3e-9 SMART
low complexity region 755 775 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
ZU5 912 1016 2e-63 SMART
low complexity region 1371 1381 N/A INTRINSIC
low complexity region 1448 1463 N/A INTRINSIC
low complexity region 1490 1503 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182078
AA Change: Y1063C
SMART Domains Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: Y1063C

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
DEATH 591 685 1e-29 SMART
low complexity region 720 736 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000182594
AA Change: Y1146C
Predicted Effect probably damaging
Transcript: ENSMUST00000182711
AA Change: Y1145C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138781
Gene: ENSMUSG00000032826
AA Change: Y1145C

DomainStartEndE-ValueType
ANK 26 55 1e1 SMART
ANK 59 88 8.9e-7 SMART
ANK 92 121 4.4e-9 SMART
ANK 125 154 2.8e-9 SMART
ANK 158 186 5.3e-1 SMART
ANK 187 216 7.3e-1 SMART
ANK 228 257 1.1e-7 SMART
ANK 261 290 4.4e-9 SMART
ANK 294 323 9.3e-8 SMART
ANK 327 356 2.1e-8 SMART
ANK 360 389 1.3e-7 SMART
ANK 393 422 6.2e-9 SMART
ANK 426 455 1.1e-7 SMART
ANK 459 488 2.9e-8 SMART
ANK 492 521 1.1e-5 SMART
ANK 525 554 6.5e-6 SMART
ANK 558 587 2.3e-7 SMART
ANK 591 620 5.3e-7 SMART
ANK 624 653 2.4e-7 SMART
ANK 657 686 3.2e-9 SMART
ANK 690 719 5.5e-5 SMART
ANK 723 752 1.9e-8 SMART
ANK 756 785 3.3e-9 SMART
low complexity region 805 825 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
ZU5 961 1098 1.1e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182959
SMART Domains Protein: ENSMUSP00000138251
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
ANK 9 38 1.63e3 SMART
ANK 42 71 1.4e-4 SMART
ANK 75 104 6.76e-7 SMART
ANK 108 137 4.46e-7 SMART
ANK 141 169 8.36e1 SMART
ANK 170 199 1.17e2 SMART
ANK 211 240 1.76e-5 SMART
ANK 244 273 6.76e-7 SMART
ANK 277 306 1.43e-5 SMART
ANK 310 339 3.33e-6 SMART
ANK 343 372 2.02e-5 SMART
ANK 376 405 9.55e-7 SMART
ANK 409 438 1.76e-5 SMART
ANK 442 471 4.71e-6 SMART
ANK 475 504 1.7e-3 SMART
ANK 508 537 1.05e-3 SMART
ANK 541 570 3.51e-5 SMART
ANK 574 603 8.65e-5 SMART
ANK 607 636 3.76e-5 SMART
ANK 640 669 5.12e-7 SMART
ANK 673 702 8.39e-3 SMART
ANK 706 735 2.9e-6 SMART
ANK 739 768 5.12e-7 SMART
low complexity region 788 808 N/A INTRINSIC
low complexity region 826 839 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
Pfam:ZU5 945 1028 1.5e-30 PFAM
Pfam:ZU5 1021 1082 4.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183075
Meta Mutation Damage Score 0.6632 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 93% (99/107)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,457,078 (GRCm39) T270A probably null Het
Adgrv1 A T 13: 81,681,241 (GRCm39) probably benign Het
Aldh1b1 A T 4: 45,803,383 (GRCm39) D307V probably benign Het
Aldh3a2 A T 11: 61,153,065 (GRCm39) C220* probably null Het
Anks1 T C 17: 28,210,351 (GRCm39) Y444H probably benign Het
Asph G T 4: 9,531,968 (GRCm39) T383K probably benign Het
Asphd1 G T 7: 126,547,747 (GRCm39) S185R possibly damaging Het
Bcl2a1d T A 9: 88,613,748 (GRCm39) I9F probably damaging Het
Bcl2l11 T C 2: 127,970,961 (GRCm39) probably benign Het
C2cd3 T G 7: 100,062,581 (GRCm39) S656A possibly damaging Het
Cd5l T C 3: 87,274,929 (GRCm39) V156A probably damaging Het
Cdh8 G C 8: 99,757,536 (GRCm39) N687K probably damaging Het
Cdk19 A G 10: 40,352,232 (GRCm39) D338G probably benign Het
Cenpf A G 1: 189,390,728 (GRCm39) C1035R probably damaging Het
Cep290 A G 10: 100,384,776 (GRCm39) R1845G probably benign Het
Cep295nl G T 11: 118,224,650 (GRCm39) Q65K probably damaging Het
Ciz1 T C 2: 32,262,300 (GRCm39) probably benign Het
Clasrp T C 7: 19,324,173 (GRCm39) D234G possibly damaging Het
Dctd C T 8: 48,590,449 (GRCm39) probably benign Het
Ddr2 A G 1: 169,832,340 (GRCm39) V150A probably benign Het
Dennd10 A G 19: 60,819,252 (GRCm39) E120G probably damaging Het
Dnah7b T C 1: 46,120,604 (GRCm39) S74P probably benign Het
Dnttip2 C A 3: 122,078,750 (GRCm39) A743E probably damaging Het
Dysf A T 6: 84,044,005 (GRCm39) Q281L possibly damaging Het
Ece2 A G 16: 20,462,905 (GRCm39) E610G probably damaging Het
Edem3 T G 1: 151,679,982 (GRCm39) probably null Het
Ext1 G T 15: 52,955,773 (GRCm39) N441K probably benign Het
Fam118a A G 15: 84,942,969 (GRCm39) R333G probably damaging Het
Fat4 C T 3: 38,945,754 (GRCm39) T1549I probably damaging Het
Fbxo4 A G 15: 4,005,394 (GRCm39) V162A probably damaging Het
Fgd2 A G 17: 29,592,223 (GRCm39) H385R possibly damaging Het
Garnl3 A T 2: 32,977,100 (GRCm39) M1K probably null Het
Gm37267 T G 1: 180,338,083 (GRCm39) noncoding transcript Het
Gpbar1 C T 1: 74,318,702 (GRCm39) A315V probably damaging Het
Grm2 T C 9: 106,524,844 (GRCm39) I624V probably benign Het
Hmcn1 T C 1: 150,468,836 (GRCm39) I5042V probably benign Het
Hnf4g T C 3: 3,716,448 (GRCm39) Y291H possibly damaging Het
Ighm A G 12: 113,385,241 (GRCm39) S240P unknown Het
Igkv4-91 A G 6: 68,745,604 (GRCm39) I98T probably damaging Het
Krt72 T C 15: 101,694,469 (GRCm39) N142S probably damaging Het
Kynu T A 2: 43,569,830 (GRCm39) Y371N possibly damaging Het
Ly9 G T 1: 171,434,898 (GRCm39) probably benign Het
Man1a2 C A 3: 100,524,372 (GRCm39) V359F probably damaging Het
Mast1 T C 8: 85,647,287 (GRCm39) I623M probably damaging Het
Mb A G 15: 76,906,687 (GRCm39) probably null Het
Mcm4 A C 16: 15,452,374 (GRCm39) L113* probably null Het
Mcub C T 3: 129,710,685 (GRCm39) W249* probably null Het
Mme T A 3: 63,247,453 (GRCm39) V246E probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrpl38 A G 11: 116,025,098 (GRCm39) Y232H probably damaging Het
Myh7b T A 2: 155,455,420 (GRCm39) M89K probably benign Het
Notch4 A G 17: 34,796,536 (GRCm39) S892G possibly damaging Het
Nt5dc3 A G 10: 86,652,941 (GRCm39) Y245C probably damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,103,852 (GRCm39) probably benign Het
Or12d12 T A 17: 37,611,095 (GRCm39) T73S probably benign Het
Or12d14-ps1 A T 17: 37,673,337 (GRCm39) I107L probably benign Het
Or14a259 A T 7: 86,012,692 (GRCm39) N284K probably damaging Het
Or5m12 T A 2: 85,734,715 (GRCm39) I228F probably benign Het
Or8b36 G T 9: 37,937,822 (GRCm39) C240F probably damaging Het
Or8k28 A T 2: 86,286,153 (GRCm39) I154N possibly damaging Het
Palld A T 8: 62,002,815 (GRCm39) probably benign Het
Pcdhga10 T C 18: 37,881,253 (GRCm39) V338A probably damaging Het
Pcdhga11 A G 18: 37,890,459 (GRCm39) Y489C probably damaging Het
Pgm2 T C 5: 64,261,237 (GRCm39) Y244H probably benign Het
Phactr4 A T 4: 132,105,759 (GRCm39) S102R probably damaging Het
Plekha5 A G 6: 140,471,636 (GRCm39) Y20C probably damaging Het
Rdh19 A G 10: 127,696,013 (GRCm39) D255G probably benign Het
Rgs3 T C 4: 62,549,532 (GRCm39) V438A probably benign Het
Rnf186 A G 4: 138,695,254 (GRCm39) T265A probably benign Het
Ror1 T C 4: 100,283,195 (GRCm39) F420S probably benign Het
Rtkn2 A G 10: 67,841,463 (GRCm39) K204E probably damaging Het
Rundc1 A G 11: 101,324,874 (GRCm39) T527A probably benign Het
Samd4 T C 14: 47,303,920 (GRCm39) S301P probably damaging Het
Scaf1 G A 7: 44,655,303 (GRCm39) probably benign Het
Srgap2 A G 1: 131,217,210 (GRCm39) V1034A probably benign Het
Stab2 T C 10: 86,778,099 (GRCm39) D743G probably damaging Het
Stim1 A T 7: 102,003,779 (GRCm39) I71F probably damaging Het
Stk17b T C 1: 53,796,693 (GRCm39) D358G probably benign Het
Sun2 A G 15: 79,611,765 (GRCm39) Y551H probably damaging Het
Tas2r110 A T 6: 132,845,091 (GRCm39) T41S probably benign Het
Tead3 T A 17: 28,552,589 (GRCm39) E268V probably damaging Het
Tead3 A G 17: 28,553,962 (GRCm39) S131P probably benign Het
Tepsin A T 11: 119,982,351 (GRCm39) M505K possibly damaging Het
Trbv28 A G 6: 41,248,668 (GRCm39) Y66C possibly damaging Het
Ttc6 A G 12: 57,749,142 (GRCm39) Q1358R probably damaging Het
Ttll2 C T 17: 7,618,998 (GRCm39) V310I probably benign Het
Uaca T C 9: 60,753,283 (GRCm39) V76A probably damaging Het
Vwf A T 6: 125,663,425 (GRCm39) T2789S probably benign Het
Yipf4 T C 17: 74,801,089 (GRCm39) F136L probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 106,210,376 (GRCm39) probably null Het
Zfp804b A T 5: 6,926,479 (GRCm39) D51E probably damaging Het
Zfyve9 C T 4: 108,538,183 (GRCm39) G969R probably damaging Het
Other mutations in Ank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Ank2 APN 3 126,753,369 (GRCm39) missense possibly damaging 0.80
IGL01652:Ank2 APN 3 126,726,690 (GRCm39) missense probably benign 0.00
IGL01969:Ank2 APN 3 126,746,872 (GRCm39) missense possibly damaging 0.47
IGL02122:Ank2 APN 3 126,731,523 (GRCm39) splice site probably benign
IGL02537:Ank2 APN 3 126,749,565 (GRCm39) missense probably damaging 1.00
IGL02858:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL02981:Ank2 APN 3 126,728,211 (GRCm39) missense possibly damaging 0.58
IGL02981:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03024:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03074:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03111:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03129:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03174:Ank2 APN 3 126,733,744 (GRCm39) missense probably damaging 0.98
IGL03177:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03185:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03188:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03242:Ank2 APN 3 126,722,454 (GRCm39) missense possibly damaging 0.90
IGL03244:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03248:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03285:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03304:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03358:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03380:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03389:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03400:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03409:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
ballast UTSW 3 126,736,782 (GRCm39) missense unknown
Chain UTSW 3 126,740,587 (GRCm39) intron probably benign
Deadman UTSW 3 126,723,471 (GRCm39) missense probably benign 0.19
drag UTSW 3 126,797,631 (GRCm39) missense probably damaging 1.00
mooring UTSW 3 126,728,226 (GRCm39) missense possibly damaging 0.73
Treasure UTSW 3 126,740,398 (GRCm39) missense unknown
Windlass UTSW 3 126,739,798 (GRCm39) missense probably benign
R0033:Ank2 UTSW 3 126,898,397 (GRCm39) splice site probably benign
R0042:Ank2 UTSW 3 126,730,280 (GRCm39) missense probably damaging 0.99
R0042:Ank2 UTSW 3 126,730,280 (GRCm39) missense probably damaging 0.99
R0079:Ank2 UTSW 3 126,728,264 (GRCm39) missense probably benign 0.01
R0423:Ank2 UTSW 3 126,723,509 (GRCm39) nonsense probably null
R0699:Ank2 UTSW 3 126,723,478 (GRCm39) missense probably benign 0.00
R0724:Ank2 UTSW 3 126,755,986 (GRCm39) missense probably damaging 1.00
R0990:Ank2 UTSW 3 126,728,315 (GRCm39) missense possibly damaging 0.64
R1450:Ank2 UTSW 3 126,750,951 (GRCm39) missense possibly damaging 0.94
R1500:Ank2 UTSW 3 126,726,631 (GRCm39) missense probably benign
R1702:Ank2 UTSW 3 126,749,548 (GRCm39) missense probably benign 0.00
R1703:Ank2 UTSW 3 126,723,415 (GRCm39) missense probably damaging 1.00
R1710:Ank2 UTSW 3 126,726,709 (GRCm39) nonsense probably null
R1743:Ank2 UTSW 3 126,722,324 (GRCm39) missense probably damaging 0.99
R1775:Ank2 UTSW 3 126,728,196 (GRCm39) missense probably benign 0.00
R1852:Ank2 UTSW 3 126,791,500 (GRCm39) critical splice donor site probably null
R2198:Ank2 UTSW 3 126,728,226 (GRCm39) missense possibly damaging 0.73
R2892:Ank2 UTSW 3 127,041,892 (GRCm39) splice site probably null
R2893:Ank2 UTSW 3 127,041,892 (GRCm39) splice site probably null
R2894:Ank2 UTSW 3 127,041,892 (GRCm39) splice site probably null
R3148:Ank2 UTSW 3 126,726,724 (GRCm39) missense probably benign 0.00
R3776:Ank2 UTSW 3 126,735,911 (GRCm39) intron probably benign
R3784:Ank2 UTSW 3 126,746,842 (GRCm39) missense probably damaging 1.00
R3856:Ank2 UTSW 3 126,723,493 (GRCm39) missense probably benign 0.00
R3906:Ank2 UTSW 3 126,810,547 (GRCm39) missense probably damaging 1.00
R3907:Ank2 UTSW 3 126,810,547 (GRCm39) missense probably damaging 1.00
R3953:Ank2 UTSW 3 126,781,809 (GRCm39) missense probably damaging 1.00
R3963:Ank2 UTSW 3 126,728,245 (GRCm39) missense probably benign
R4367:Ank2 UTSW 3 126,739,798 (GRCm39) missense probably benign
R4414:Ank2 UTSW 3 127,019,411 (GRCm39) critical splice donor site probably null
R4432:Ank2 UTSW 3 126,741,455 (GRCm39) intron probably benign
R4433:Ank2 UTSW 3 126,741,455 (GRCm39) intron probably benign
R4579:Ank2 UTSW 3 126,752,612 (GRCm39) missense probably damaging 1.00
R4597:Ank2 UTSW 3 126,781,800 (GRCm39) missense probably damaging 1.00
R4603:Ank2 UTSW 3 126,825,665 (GRCm39) missense probably benign 0.00
R4729:Ank2 UTSW 3 126,770,545 (GRCm39) nonsense probably null
R4815:Ank2 UTSW 3 126,730,410 (GRCm39) missense probably benign
R4826:Ank2 UTSW 3 126,749,650 (GRCm39) missense probably benign 0.35
R4880:Ank2 UTSW 3 126,840,475 (GRCm39) splice site probably null
R4915:Ank2 UTSW 3 126,736,320 (GRCm39) intron probably benign
R4935:Ank2 UTSW 3 126,749,713 (GRCm39) missense probably damaging 1.00
R4936:Ank2 UTSW 3 126,748,688 (GRCm39) missense possibly damaging 0.94
R4937:Ank2 UTSW 3 126,756,050 (GRCm39) missense probably damaging 1.00
R4946:Ank2 UTSW 3 126,735,589 (GRCm39) intron probably benign
R4963:Ank2 UTSW 3 126,825,745 (GRCm39) missense probably benign 0.01
R4989:Ank2 UTSW 3 126,757,094 (GRCm39) missense possibly damaging 0.94
R5023:Ank2 UTSW 3 126,735,520 (GRCm39) intron probably benign
R5060:Ank2 UTSW 3 126,739,570 (GRCm39) intron probably benign
R5078:Ank2 UTSW 3 126,736,002 (GRCm39) intron probably benign
R5086:Ank2 UTSW 3 126,740,997 (GRCm39) intron probably benign
R5134:Ank2 UTSW 3 126,757,094 (GRCm39) missense possibly damaging 0.94
R5148:Ank2 UTSW 3 126,819,285 (GRCm39) splice site probably null
R5175:Ank2 UTSW 3 126,797,673 (GRCm39) missense probably damaging 1.00
R5275:Ank2 UTSW 3 126,825,832 (GRCm39) missense probably damaging 1.00
R5295:Ank2 UTSW 3 126,825,832 (GRCm39) missense probably damaging 1.00
R5303:Ank2 UTSW 3 126,739,453 (GRCm39) intron probably benign
R5309:Ank2 UTSW 3 126,753,417 (GRCm39) missense probably damaging 0.99
R5312:Ank2 UTSW 3 126,753,417 (GRCm39) missense probably damaging 0.99
R5352:Ank2 UTSW 3 127,292,640 (GRCm39) utr 5 prime probably benign
R5355:Ank2 UTSW 3 126,737,698 (GRCm39) intron probably benign
R5386:Ank2 UTSW 3 126,775,582 (GRCm39) missense probably benign 0.01
R5396:Ank2 UTSW 3 126,746,875 (GRCm39) missense probably damaging 1.00
R5518:Ank2 UTSW 3 126,753,348 (GRCm39) missense probably damaging 0.98
R5534:Ank2 UTSW 3 126,740,947 (GRCm39) intron probably benign
R5554:Ank2 UTSW 3 126,792,622 (GRCm39) missense possibly damaging 0.78
R5582:Ank2 UTSW 3 126,739,954 (GRCm39) intron probably benign
R5747:Ank2 UTSW 3 126,735,400 (GRCm39) intron probably benign
R5794:Ank2 UTSW 3 126,723,669 (GRCm39) missense probably benign 0.00
R5831:Ank2 UTSW 3 127,132,808 (GRCm39) start gained probably benign
R5925:Ank2 UTSW 3 126,726,612 (GRCm39) missense probably benign 0.18
R5954:Ank2 UTSW 3 126,791,510 (GRCm39) missense probably benign 0.34
R5956:Ank2 UTSW 3 126,736,337 (GRCm39) intron probably benign
R5986:Ank2 UTSW 3 126,806,335 (GRCm39) missense possibly damaging 0.94
R5992:Ank2 UTSW 3 126,753,300 (GRCm39) critical splice donor site probably null
R6020:Ank2 UTSW 3 126,740,470 (GRCm39) intron probably benign
R6027:Ank2 UTSW 3 126,791,528 (GRCm39) missense possibly damaging 0.92
R6049:Ank2 UTSW 3 126,736,669 (GRCm39) missense possibly damaging 0.95
R6060:Ank2 UTSW 3 126,749,601 (GRCm39) missense probably damaging 1.00
R6114:Ank2 UTSW 3 126,804,700 (GRCm39) missense probably damaging 1.00
R6124:Ank2 UTSW 3 127,041,800 (GRCm39) missense probably benign 0.31
R6156:Ank2 UTSW 3 126,737,886 (GRCm39) missense probably damaging 1.00
R6173:Ank2 UTSW 3 126,846,395 (GRCm39) missense probably damaging 1.00
R6176:Ank2 UTSW 3 126,739,120 (GRCm39) missense probably benign 0.05
R6184:Ank2 UTSW 3 126,756,047 (GRCm39) missense probably damaging 1.00
R6199:Ank2 UTSW 3 126,797,655 (GRCm39) missense probably damaging 1.00
R6241:Ank2 UTSW 3 126,846,397 (GRCm39) missense probably damaging 1.00
R6254:Ank2 UTSW 3 126,735,453 (GRCm39) intron probably benign
R6259:Ank2 UTSW 3 126,810,635 (GRCm39) missense probably benign 0.28
R6260:Ank2 UTSW 3 126,737,206 (GRCm39) missense probably benign
R6321:Ank2 UTSW 3 126,740,587 (GRCm39) intron probably benign
R6393:Ank2 UTSW 3 126,723,406 (GRCm39) missense probably damaging 1.00
R6406:Ank2 UTSW 3 126,825,874 (GRCm39) missense probably damaging 1.00
R6544:Ank2 UTSW 3 126,726,871 (GRCm39) missense probably damaging 0.99
R6583:Ank2 UTSW 3 126,810,613 (GRCm39) missense probably damaging 1.00
R6739:Ank2 UTSW 3 126,873,643 (GRCm39) missense probably damaging 1.00
R6754:Ank2 UTSW 3 126,890,488 (GRCm39) intron probably benign
R6786:Ank2 UTSW 3 126,752,581 (GRCm39) missense probably damaging 0.99
R6798:Ank2 UTSW 3 126,737,913 (GRCm39) intron probably benign
R6882:Ank2 UTSW 3 126,739,406 (GRCm39) intron probably benign
R6940:Ank2 UTSW 3 126,735,621 (GRCm39) intron probably benign
R6949:Ank2 UTSW 3 126,804,533 (GRCm39) missense probably benign 0.00
R7001:Ank2 UTSW 3 126,871,230 (GRCm39) missense probably damaging 1.00
R7033:Ank2 UTSW 3 126,738,499 (GRCm39) nonsense probably null
R7036:Ank2 UTSW 3 126,740,041 (GRCm39) intron probably benign
R7045:Ank2 UTSW 3 126,806,393 (GRCm39) missense probably damaging 1.00
R7048:Ank2 UTSW 3 126,819,267 (GRCm39) missense probably benign 0.03
R7054:Ank2 UTSW 3 126,736,952 (GRCm39) intron probably benign
R7069:Ank2 UTSW 3 126,739,947 (GRCm39) intron probably benign
R7091:Ank2 UTSW 3 126,817,000 (GRCm39) missense probably damaging 0.98
R7107:Ank2 UTSW 3 126,797,631 (GRCm39) missense probably damaging 1.00
R7175:Ank2 UTSW 3 126,740,590 (GRCm39) missense unknown
R7191:Ank2 UTSW 3 126,740,041 (GRCm39) missense unknown
R7272:Ank2 UTSW 3 126,736,782 (GRCm39) missense unknown
R7381:Ank2 UTSW 3 126,730,277 (GRCm39) missense possibly damaging 0.46
R7394:Ank2 UTSW 3 126,730,302 (GRCm39) missense possibly damaging 0.77
R7462:Ank2 UTSW 3 126,736,683 (GRCm39) missense unknown
R7490:Ank2 UTSW 3 126,752,538 (GRCm39) missense probably damaging 0.99
R7514:Ank2 UTSW 3 126,819,252 (GRCm39) missense probably benign 0.06
R7534:Ank2 UTSW 3 126,727,982 (GRCm39) splice site probably null
R7540:Ank2 UTSW 3 126,781,808 (GRCm39) missense possibly damaging 0.94
R7547:Ank2 UTSW 3 126,738,852 (GRCm39) missense unknown
R7579:Ank2 UTSW 3 126,740,047 (GRCm39) missense unknown
R7584:Ank2 UTSW 3 126,739,777 (GRCm39) nonsense probably null
R7625:Ank2 UTSW 3 126,846,449 (GRCm39) missense probably damaging 1.00
R7698:Ank2 UTSW 3 126,825,860 (GRCm39) missense probably benign 0.35
R7716:Ank2 UTSW 3 126,736,815 (GRCm39) missense unknown
R7718:Ank2 UTSW 3 126,758,662 (GRCm39) missense possibly damaging 0.88
R7722:Ank2 UTSW 3 126,822,951 (GRCm39) missense probably benign 0.01
R7738:Ank2 UTSW 3 126,741,271 (GRCm39) missense
R7977:Ank2 UTSW 3 126,739,356 (GRCm39) missense unknown
R7987:Ank2 UTSW 3 126,739,356 (GRCm39) missense unknown
R8007:Ank2 UTSW 3 126,730,096 (GRCm39) intron probably benign
R8150:Ank2 UTSW 3 126,741,162 (GRCm39) missense
R8161:Ank2 UTSW 3 126,825,778 (GRCm39) missense
R8196:Ank2 UTSW 3 126,723,532 (GRCm39) missense probably damaging 0.99
R8248:Ank2 UTSW 3 126,731,434 (GRCm39) missense possibly damaging 0.78
R8255:Ank2 UTSW 3 126,740,398 (GRCm39) missense unknown
R8279:Ank2 UTSW 3 126,726,820 (GRCm39) missense probably benign 0.04
R8300:Ank2 UTSW 3 126,804,555 (GRCm39) missense
R8716:Ank2 UTSW 3 126,736,488 (GRCm39) nonsense probably null
R8724:Ank2 UTSW 3 126,737,405 (GRCm39) missense unknown
R8765:Ank2 UTSW 3 126,850,731 (GRCm39) missense possibly damaging 0.94
R8779:Ank2 UTSW 3 126,758,751 (GRCm39) missense probably damaging 0.99
R8783:Ank2 UTSW 3 126,846,455 (GRCm39) missense probably damaging 1.00
R8785:Ank2 UTSW 3 126,791,570 (GRCm39) missense probably damaging 1.00
R8826:Ank2 UTSW 3 126,740,951 (GRCm39) missense unknown
R8872:Ank2 UTSW 3 126,791,525 (GRCm39) missense possibly damaging 0.88
R8903:Ank2 UTSW 3 126,840,431 (GRCm39) missense probably damaging 1.00
R8906:Ank2 UTSW 3 126,726,720 (GRCm39) missense probably benign 0.00
R8918:Ank2 UTSW 3 126,737,380 (GRCm39) missense unknown
R8947:Ank2 UTSW 3 126,736,396 (GRCm39) intron probably benign
R8977:Ank2 UTSW 3 126,738,575 (GRCm39) missense unknown
R8990:Ank2 UTSW 3 126,841,829 (GRCm39) critical splice donor site probably null
R8994:Ank2 UTSW 3 126,723,471 (GRCm39) missense probably benign 0.19
R9009:Ank2 UTSW 3 126,728,025 (GRCm39) unclassified probably benign
R9123:Ank2 UTSW 3 126,733,744 (GRCm39) missense probably damaging 1.00
R9125:Ank2 UTSW 3 126,733,744 (GRCm39) missense probably damaging 1.00
R9130:Ank2 UTSW 3 126,810,565 (GRCm39) missense
R9175:Ank2 UTSW 3 126,722,402 (GRCm39) missense possibly damaging 0.52
R9220:Ank2 UTSW 3 126,737,086 (GRCm39) missense unknown
R9225:Ank2 UTSW 3 126,736,111 (GRCm39) missense unknown
R9286:Ank2 UTSW 3 126,846,381 (GRCm39) missense probably damaging 0.99
R9325:Ank2 UTSW 3 126,775,504 (GRCm39) missense probably damaging 0.98
R9367:Ank2 UTSW 3 126,738,678 (GRCm39) missense unknown
R9385:Ank2 UTSW 3 126,753,366 (GRCm39) missense probably benign 0.00
R9391:Ank2 UTSW 3 126,731,394 (GRCm39) missense probably damaging 0.99
R9422:Ank2 UTSW 3 126,890,505 (GRCm39) missense unknown
R9536:Ank2 UTSW 3 126,736,031 (GRCm39) missense unknown
R9647:Ank2 UTSW 3 126,792,623 (GRCm39) missense possibly damaging 0.93
R9650:Ank2 UTSW 3 126,735,829 (GRCm39) missense unknown
R9666:Ank2 UTSW 3 126,726,838 (GRCm39) nonsense probably null
R9686:Ank2 UTSW 3 126,740,550 (GRCm39) missense unknown
R9730:Ank2 UTSW 3 127,019,493 (GRCm39) missense
R9738:Ank2 UTSW 3 126,737,121 (GRCm39) missense unknown
R9743:Ank2 UTSW 3 126,733,794 (GRCm39) missense possibly damaging 0.81
R9747:Ank2 UTSW 3 126,752,667 (GRCm39) missense probably damaging 1.00
R9800:Ank2 UTSW 3 126,740,149 (GRCm39) missense unknown
R9803:Ank2 UTSW 3 126,752,726 (GRCm39) missense possibly damaging 0.64
RF020:Ank2 UTSW 3 126,739,125 (GRCm39) missense unknown
Z1088:Ank2 UTSW 3 126,823,158 (GRCm39) missense possibly damaging 0.45
Z1177:Ank2 UTSW 3 126,738,006 (GRCm39) missense unknown
Z1187:Ank2 UTSW 3 126,749,601 (GRCm39) missense probably damaging 1.00
Z1190:Ank2 UTSW 3 126,749,601 (GRCm39) missense probably damaging 1.00
Z1192:Ank2 UTSW 3 126,749,601 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCGTCTGCATCCTACGTG -3'
(R):5'- GCTGACAGCTGATAAACTATCCC -3'

Sequencing Primer
(F):5'- TACGTGGACATACCTGTAGGC -3'
(R):5'- TAACTAAAAAGGGGTTTGCTGCCC -3'
Posted On 2016-03-17