Incidental Mutation 'R4871:Ror1'
ID376568
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
MMRRC Submission 042481-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4871 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100425998 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 420 (F420S)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect probably benign
Transcript: ENSMUST00000039630
AA Change: F420S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: F420S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 93% (99/107)
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,480,093 T270A probably null Het
Adgrv1 A T 13: 81,533,122 probably benign Het
Aldh1b1 A T 4: 45,803,383 D307V probably benign Het
Aldh3a2 A T 11: 61,262,239 C220* probably null Het
Ank2 T C 3: 126,959,795 Y279C probably damaging Het
Anks1 T C 17: 27,991,377 Y444H probably benign Het
Asph G T 4: 9,531,968 T383K probably benign Het
Asphd1 G T 7: 126,948,575 S185R possibly damaging Het
Bcl2a1d T A 9: 88,731,695 I9F probably damaging Het
Bcl2l11 T C 2: 128,129,041 probably benign Het
C2cd3 T G 7: 100,413,374 S656A possibly damaging Het
Ccdc109b C T 3: 129,917,036 W249* probably null Het
Cd5l T C 3: 87,367,622 V156A probably damaging Het
Cdh8 G C 8: 99,030,904 N687K probably damaging Het
Cdk19 A G 10: 40,476,236 D338G probably benign Het
Cenpf A G 1: 189,658,531 C1035R probably damaging Het
Cep290 A G 10: 100,548,914 R1845G probably benign Het
Cep295nl G T 11: 118,333,824 Q65K probably damaging Het
Ciz1 T C 2: 32,372,288 probably benign Het
Clasrp T C 7: 19,590,248 D234G possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Ddr2 A G 1: 170,004,771 V150A probably benign Het
Dnah7b T C 1: 46,081,444 S74P probably benign Het
Dnttip2 C A 3: 122,285,101 A743E probably damaging Het
Dysf A T 6: 84,067,023 Q281L possibly damaging Het
Ece2 A G 16: 20,644,155 E610G probably damaging Het
Edem3 T G 1: 151,804,231 probably null Het
Ext1 G T 15: 53,092,377 N441K probably benign Het
Fam118a A G 15: 85,058,768 R333G probably damaging Het
Fam45a A G 19: 60,830,814 E120G probably damaging Het
Fat4 C T 3: 38,891,605 T1549I probably damaging Het
Fbxo4 A G 15: 3,975,912 V162A probably damaging Het
Fgd2 A G 17: 29,373,249 H385R possibly damaging Het
Garnl3 A T 2: 33,087,088 M1K probably null Het
Gm37267 T G 1: 180,510,518 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbar1 C T 1: 74,279,543 A315V probably damaging Het
Grm2 T C 9: 106,647,645 I624V probably benign Het
Hmcn1 T C 1: 150,593,085 I5042V probably benign Het
Hnf4g T C 3: 3,651,388 Y291H possibly damaging Het
Ighm A G 12: 113,421,621 S240P unknown Het
Igkv4-91 A G 6: 68,768,620 I98T probably damaging Het
Krt72 T C 15: 101,786,034 N142S probably damaging Het
Kynu T A 2: 43,679,818 Y371N possibly damaging Het
Ly9 G T 1: 171,607,330 probably benign Het
Man1a2 C A 3: 100,617,056 V359F probably damaging Het
Mast1 T C 8: 84,920,658 I623M probably damaging Het
Mb A G 15: 77,022,487 probably null Het
Mcm4 A C 16: 15,634,510 L113* probably null Het
Mme T A 3: 63,340,032 V246E probably benign Het
Mrpl38 A G 11: 116,134,272 Y232H probably damaging Het
Myh7b T A 2: 155,613,500 M89K probably benign Het
Notch4 A G 17: 34,577,562 S892G possibly damaging Het
Nt5dc3 A G 10: 86,817,077 Y245C probably damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr101 T A 17: 37,300,204 T73S probably benign Het
Olfr1024 T A 2: 85,904,371 I228F probably benign Het
Olfr104-ps A T 17: 37,362,446 I107L probably benign Het
Olfr1066 A T 2: 86,455,809 I154N possibly damaging Het
Olfr305 A T 7: 86,363,484 N284K probably damaging Het
Olfr883 G T 9: 38,026,526 C240F probably damaging Het
Palld A T 8: 61,549,781 probably benign Het
Pcdhga10 T C 18: 37,748,200 V338A probably damaging Het
Pcdhga11 A G 18: 37,757,406 Y489C probably damaging Het
Pgm1 T C 5: 64,103,894 Y244H probably benign Het
Phactr4 A T 4: 132,378,448 S102R probably damaging Het
Plekha5 A G 6: 140,525,910 Y20C probably damaging Het
Rdh19 A G 10: 127,860,144 D255G probably benign Het
Rgs3 T C 4: 62,631,295 V438A probably benign Het
Rnf186 A G 4: 138,967,943 T265A probably benign Het
Rtkn2 A G 10: 68,005,633 K204E probably damaging Het
Rundc1 A G 11: 101,434,048 T527A probably benign Het
Samd4 T C 14: 47,066,463 S301P probably damaging Het
Scaf1 G A 7: 45,005,879 probably benign Het
Srgap2 A G 1: 131,289,472 V1034A probably benign Het
Stab2 T C 10: 86,942,235 D743G probably damaging Het
Stim1 A T 7: 102,354,572 I71F probably damaging Het
Stk17b T C 1: 53,757,534 D358G probably benign Het
Sun2 A G 15: 79,727,564 Y551H probably damaging Het
Tas2r110 A T 6: 132,868,128 T41S probably benign Het
Tead3 T A 17: 28,333,615 E268V probably damaging Het
Tead3 A G 17: 28,334,988 S131P probably benign Het
Tepsin A T 11: 120,091,525 M505K possibly damaging Het
Trbv29 A G 6: 41,271,734 Y66C possibly damaging Het
Ttc6 A G 12: 57,702,356 Q1358R probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Uaca T C 9: 60,846,001 V76A probably damaging Het
Vwf A T 6: 125,686,462 T2789S probably benign Het
Yipf4 T C 17: 74,494,094 F136L probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp804b A T 5: 6,876,479 D51E probably damaging Het
Zfyve9 C T 4: 108,680,986 G969R probably damaging Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense probably benign 0.00
R7350:Ror1 UTSW 4 100425943 missense probably benign 0.00
R7492:Ror1 UTSW 4 100441059 missense probably benign 0.22
R7502:Ror1 UTSW 4 100333630 missense probably benign 0.03
R7531:Ror1 UTSW 4 100441191 missense probably damaging 1.00
R7661:Ror1 UTSW 4 100441490 missense probably damaging 1.00
R7822:Ror1 UTSW 4 100441367 missense probably damaging 1.00
R7831:Ror1 UTSW 4 100441098 missense probably benign 0.01
R7914:Ror1 UTSW 4 100441098 missense probably benign 0.01
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Z1177:Ror1 UTSW 4 100302919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTTCACAATGTCCAGCTG -3'
(R):5'- TTCAAGCAGGAGGGCTGTAG -3'

Sequencing Primer
(F):5'- TGTCCAGCTGTGATTTTCAAAC -3'
(R):5'- GCTGTAGCAGGTCACTCTC -3'
Posted On2016-03-17