Incidental Mutation 'R4871:Zfyve9'
ID376569
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Namezinc finger, FYVE domain containing 9
SynonymsMadhip
MMRRC Submission 042481-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R4871 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108637466-108780798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108680986 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 969 (G969R)
Ref Sequence ENSEMBL: ENSMUSP00000102269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]
Predicted Effect probably damaging
Transcript: ENSMUST00000042185
AA Change: G337R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: G337R

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106657
AA Change: G1028R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: G1028R

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106658
AA Change: G969R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: G969R

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Meta Mutation Damage Score 0.8975 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 93% (99/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,480,093 T270A probably null Het
Adgrv1 A T 13: 81,533,122 probably benign Het
Aldh1b1 A T 4: 45,803,383 D307V probably benign Het
Aldh3a2 A T 11: 61,262,239 C220* probably null Het
Ank2 T C 3: 126,959,795 Y279C probably damaging Het
Anks1 T C 17: 27,991,377 Y444H probably benign Het
Asph G T 4: 9,531,968 T383K probably benign Het
Asphd1 G T 7: 126,948,575 S185R possibly damaging Het
Bcl2a1d T A 9: 88,731,695 I9F probably damaging Het
Bcl2l11 T C 2: 128,129,041 probably benign Het
C2cd3 T G 7: 100,413,374 S656A possibly damaging Het
Ccdc109b C T 3: 129,917,036 W249* probably null Het
Cd5l T C 3: 87,367,622 V156A probably damaging Het
Cdh8 G C 8: 99,030,904 N687K probably damaging Het
Cdk19 A G 10: 40,476,236 D338G probably benign Het
Cenpf A G 1: 189,658,531 C1035R probably damaging Het
Cep290 A G 10: 100,548,914 R1845G probably benign Het
Cep295nl G T 11: 118,333,824 Q65K probably damaging Het
Ciz1 T C 2: 32,372,288 probably benign Het
Clasrp T C 7: 19,590,248 D234G possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Ddr2 A G 1: 170,004,771 V150A probably benign Het
Dnah7b T C 1: 46,081,444 S74P probably benign Het
Dnttip2 C A 3: 122,285,101 A743E probably damaging Het
Dysf A T 6: 84,067,023 Q281L possibly damaging Het
Ece2 A G 16: 20,644,155 E610G probably damaging Het
Edem3 T G 1: 151,804,231 probably null Het
Ext1 G T 15: 53,092,377 N441K probably benign Het
Fam118a A G 15: 85,058,768 R333G probably damaging Het
Fam45a A G 19: 60,830,814 E120G probably damaging Het
Fat4 C T 3: 38,891,605 T1549I probably damaging Het
Fbxo4 A G 15: 3,975,912 V162A probably damaging Het
Fgd2 A G 17: 29,373,249 H385R possibly damaging Het
Garnl3 A T 2: 33,087,088 M1K probably null Het
Gm37267 T G 1: 180,510,518 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbar1 C T 1: 74,279,543 A315V probably damaging Het
Grm2 T C 9: 106,647,645 I624V probably benign Het
Hmcn1 T C 1: 150,593,085 I5042V probably benign Het
Hnf4g T C 3: 3,651,388 Y291H possibly damaging Het
Ighm A G 12: 113,421,621 S240P unknown Het
Igkv4-91 A G 6: 68,768,620 I98T probably damaging Het
Krt72 T C 15: 101,786,034 N142S probably damaging Het
Kynu T A 2: 43,679,818 Y371N possibly damaging Het
Ly9 G T 1: 171,607,330 probably benign Het
Man1a2 C A 3: 100,617,056 V359F probably damaging Het
Mast1 T C 8: 84,920,658 I623M probably damaging Het
Mb A G 15: 77,022,487 probably null Het
Mcm4 A C 16: 15,634,510 L113* probably null Het
Mme T A 3: 63,340,032 V246E probably benign Het
Mrpl38 A G 11: 116,134,272 Y232H probably damaging Het
Myh7b T A 2: 155,613,500 M89K probably benign Het
Notch4 A G 17: 34,577,562 S892G possibly damaging Het
Nt5dc3 A G 10: 86,817,077 Y245C probably damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr101 T A 17: 37,300,204 T73S probably benign Het
Olfr1024 T A 2: 85,904,371 I228F probably benign Het
Olfr104-ps A T 17: 37,362,446 I107L probably benign Het
Olfr1066 A T 2: 86,455,809 I154N possibly damaging Het
Olfr305 A T 7: 86,363,484 N284K probably damaging Het
Olfr883 G T 9: 38,026,526 C240F probably damaging Het
Palld A T 8: 61,549,781 probably benign Het
Pcdhga10 T C 18: 37,748,200 V338A probably damaging Het
Pcdhga11 A G 18: 37,757,406 Y489C probably damaging Het
Pgm1 T C 5: 64,103,894 Y244H probably benign Het
Phactr4 A T 4: 132,378,448 S102R probably damaging Het
Plekha5 A G 6: 140,525,910 Y20C probably damaging Het
Rdh19 A G 10: 127,860,144 D255G probably benign Het
Rgs3 T C 4: 62,631,295 V438A probably benign Het
Rnf186 A G 4: 138,967,943 T265A probably benign Het
Ror1 T C 4: 100,425,998 F420S probably benign Het
Rtkn2 A G 10: 68,005,633 K204E probably damaging Het
Rundc1 A G 11: 101,434,048 T527A probably benign Het
Samd4 T C 14: 47,066,463 S301P probably damaging Het
Scaf1 G A 7: 45,005,879 probably benign Het
Srgap2 A G 1: 131,289,472 V1034A probably benign Het
Stab2 T C 10: 86,942,235 D743G probably damaging Het
Stim1 A T 7: 102,354,572 I71F probably damaging Het
Stk17b T C 1: 53,757,534 D358G probably benign Het
Sun2 A G 15: 79,727,564 Y551H probably damaging Het
Tas2r110 A T 6: 132,868,128 T41S probably benign Het
Tead3 T A 17: 28,333,615 E268V probably damaging Het
Tead3 A G 17: 28,334,988 S131P probably benign Het
Tepsin A T 11: 120,091,525 M505K possibly damaging Het
Trbv29 A G 6: 41,271,734 Y66C possibly damaging Het
Ttc6 A G 12: 57,702,356 Q1358R probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Uaca T C 9: 60,846,001 V76A probably damaging Het
Vwf A T 6: 125,686,462 T2789S probably benign Het
Yipf4 T C 17: 74,494,094 F136L probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp804b A T 5: 6,876,479 D51E probably damaging Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108642107 missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108681064 missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108682151 missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108682260 missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108642092 missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108674523 missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108682223 missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108695825 missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108689209 missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108723799 splice site probably benign
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108680969 missense probably damaging 0.96
R0502:Zfyve9 UTSW 4 108719764 nonsense probably null
R0503:Zfyve9 UTSW 4 108719764 nonsense probably null
R0557:Zfyve9 UTSW 4 108674511 missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108718669 missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108650229 missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108693311 intron probably benign
R1527:Zfyve9 UTSW 4 108695767 critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108684907 critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108660577 nonsense probably null
R1728:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108682295 splice site probably benign
R1983:Zfyve9 UTSW 4 108689189 missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108718603 missense probably benign 0.05
R2050:Zfyve9 UTSW 4 108719303 missense possibly damaging 0.94
R2246:Zfyve9 UTSW 4 108689264 missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108660614 missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108695819 missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108719743 missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108719701 missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108719192 missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108680976 missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108644368 missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108717998 missense possibly damaging 0.70
R4881:Zfyve9 UTSW 4 108727491 splice site probably null
R4974:Zfyve9 UTSW 4 108680900 critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108691669 missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108644349 missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108719168 missense probably benign
R5965:Zfyve9 UTSW 4 108691681 missense possibly damaging 0.53
R5996:Zfyve9 UTSW 4 108719360 missense probably benign 0.07
R6315:Zfyve9 UTSW 4 108674488 missense probably damaging 1.00
R6772:Zfyve9 UTSW 4 108639269 missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108644361 missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108650322 missense probably benign 0.00
R7258:Zfyve9 UTSW 4 108656954 missense possibly damaging 0.94
R7266:Zfyve9 UTSW 4 108718547 missense possibly damaging 0.62
R7287:Zfyve9 UTSW 4 108718256 missense probably benign 0.00
R7356:Zfyve9 UTSW 4 108719015 missense probably benign 0.01
R7389:Zfyve9 UTSW 4 108693318 critical splice donor site probably null
R7729:Zfyve9 UTSW 4 108691776 missense probably benign 0.01
R7780:Zfyve9 UTSW 4 108719101 missense possibly damaging 0.81
R7801:Zfyve9 UTSW 4 108684995 missense possibly damaging 0.50
R8069:Zfyve9 UTSW 4 108685018 missense probably benign 0.32
R8201:Zfyve9 UTSW 4 108650277 missense possibly damaging 0.83
R8221:Zfyve9 UTSW 4 108719680 missense possibly damaging 0.77
R8682:Zfyve9 UTSW 4 108719342 missense probably benign 0.30
R8948:Zfyve9 UTSW 4 108642091 missense possibly damaging 0.84
R8960:Zfyve9 UTSW 4 108644361 missense possibly damaging 0.71
Z1176:Zfyve9 UTSW 4 108642207 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTGAATTGTAACACCAGAGGGG -3'
(R):5'- TTCACAGGGAAAGATTGGGAATTTG -3'

Sequencing Primer
(F):5'- CACCAGAGGGGGATCAAATATTTC -3'
(R):5'- AGGGAAAGATTGGGAATTTGTGTTTG -3'
Posted On2016-03-17