Incidental Mutation 'R4871:Adcyap1r1'
ID376576
Institutional Source Beutler Lab
Gene Symbol Adcyap1r1
Ensembl Gene ENSMUSG00000029778
Gene Nameadenylate cyclase activating polypeptide 1 receptor 1
SynonymsPAC1R, PAC1, PACAP1-R, 2900024I10Rik
MMRRC Submission 042481-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R4871 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55451978-55501451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55480093 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 270 (T270A)
Ref Sequence ENSEMBL: ENSMUSP00000126994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070736] [ENSMUST00000070756] [ENSMUST00000165786] [ENSMUST00000165857] [ENSMUST00000166962] [ENSMUST00000167234] [ENSMUST00000172084]
Predicted Effect probably null
Transcript: ENSMUST00000070736
AA Change: T270A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000063784
Gene: ENSMUSG00000029778
AA Change: T270A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 3.6e-92 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000070756
AA Change: T270A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066902
Gene: ENSMUSG00000029778
AA Change: T270A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 396 2.6e-93 PFAM
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165786
AA Change: T270A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130923
Gene: ENSMUSG00000029778
AA Change: T270A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 423 2.6e-92 PFAM
low complexity region 473 488 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165857
AA Change: T270A

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129614
Gene: ENSMUSG00000029778
AA Change: T270A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 1.4e-94 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166962
SMART Domains Protein: ENSMUSP00000130742
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:HRM 51 131 2.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167234
AA Change: T270A

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126994
Gene: ENSMUSG00000029778
AA Change: T270A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 452 1.4e-91 PFAM
low complexity region 502 517 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172084
AA Change: T249A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127319
Gene: ENSMUSG00000029778
AA Change: T249A

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 122 2.15e-27 SMART
Pfam:7tm_2 129 375 9e-94 PFAM
low complexity region 425 440 N/A INTRINSIC
Meta Mutation Damage Score 0.1422 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 93% (99/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes type I adenylate cyclase activating polypeptide receptor, which is a membrane-associated protein and shares significant homology with members of the glucagon/secretin receptor family. This receptor mediates diverse biological actions of adenylate cyclase activating polypeptide 1 and is positively coupled to adenylate cyclase. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted mutations affect contextual fear conditioning, elevated locomotor activity, anxiety-like behavior, susceptibility to endotoxic shock, circadian responses to a photic stimulus, and glucose tolerance. Some alleles affect female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,533,122 probably benign Het
Aldh1b1 A T 4: 45,803,383 D307V probably benign Het
Aldh3a2 A T 11: 61,262,239 C220* probably null Het
Ank2 T C 3: 126,959,795 Y279C probably damaging Het
Anks1 T C 17: 27,991,377 Y444H probably benign Het
Asph G T 4: 9,531,968 T383K probably benign Het
Asphd1 G T 7: 126,948,575 S185R possibly damaging Het
Bcl2a1d T A 9: 88,731,695 I9F probably damaging Het
Bcl2l11 T C 2: 128,129,041 probably benign Het
C2cd3 T G 7: 100,413,374 S656A possibly damaging Het
Ccdc109b C T 3: 129,917,036 W249* probably null Het
Cd5l T C 3: 87,367,622 V156A probably damaging Het
Cdh8 G C 8: 99,030,904 N687K probably damaging Het
Cdk19 A G 10: 40,476,236 D338G probably benign Het
Cenpf A G 1: 189,658,531 C1035R probably damaging Het
Cep290 A G 10: 100,548,914 R1845G probably benign Het
Cep295nl G T 11: 118,333,824 Q65K probably damaging Het
Ciz1 T C 2: 32,372,288 probably benign Het
Clasrp T C 7: 19,590,248 D234G possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Ddr2 A G 1: 170,004,771 V150A probably benign Het
Dnah7b T C 1: 46,081,444 S74P probably benign Het
Dnttip2 C A 3: 122,285,101 A743E probably damaging Het
Dysf A T 6: 84,067,023 Q281L possibly damaging Het
Ece2 A G 16: 20,644,155 E610G probably damaging Het
Edem3 T G 1: 151,804,231 probably null Het
Ext1 G T 15: 53,092,377 N441K probably benign Het
Fam118a A G 15: 85,058,768 R333G probably damaging Het
Fam45a A G 19: 60,830,814 E120G probably damaging Het
Fat4 C T 3: 38,891,605 T1549I probably damaging Het
Fbxo4 A G 15: 3,975,912 V162A probably damaging Het
Fgd2 A G 17: 29,373,249 H385R possibly damaging Het
Garnl3 A T 2: 33,087,088 M1K probably null Het
Gm37267 T G 1: 180,510,518 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbar1 C T 1: 74,279,543 A315V probably damaging Het
Grm2 T C 9: 106,647,645 I624V probably benign Het
Hmcn1 T C 1: 150,593,085 I5042V probably benign Het
Hnf4g T C 3: 3,651,388 Y291H possibly damaging Het
Ighm A G 12: 113,421,621 S240P unknown Het
Igkv4-91 A G 6: 68,768,620 I98T probably damaging Het
Krt72 T C 15: 101,786,034 N142S probably damaging Het
Kynu T A 2: 43,679,818 Y371N possibly damaging Het
Ly9 G T 1: 171,607,330 probably benign Het
Man1a2 C A 3: 100,617,056 V359F probably damaging Het
Mast1 T C 8: 84,920,658 I623M probably damaging Het
Mb A G 15: 77,022,487 probably null Het
Mcm4 A C 16: 15,634,510 L113* probably null Het
Mme T A 3: 63,340,032 V246E probably benign Het
Mrpl38 A G 11: 116,134,272 Y232H probably damaging Het
Myh7b T A 2: 155,613,500 M89K probably benign Het
Notch4 A G 17: 34,577,562 S892G possibly damaging Het
Nt5dc3 A G 10: 86,817,077 Y245C probably damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr101 T A 17: 37,300,204 T73S probably benign Het
Olfr1024 T A 2: 85,904,371 I228F probably benign Het
Olfr104-ps A T 17: 37,362,446 I107L probably benign Het
Olfr1066 A T 2: 86,455,809 I154N possibly damaging Het
Olfr305 A T 7: 86,363,484 N284K probably damaging Het
Olfr883 G T 9: 38,026,526 C240F probably damaging Het
Palld A T 8: 61,549,781 probably benign Het
Pcdhga10 T C 18: 37,748,200 V338A probably damaging Het
Pcdhga11 A G 18: 37,757,406 Y489C probably damaging Het
Pgm1 T C 5: 64,103,894 Y244H probably benign Het
Phactr4 A T 4: 132,378,448 S102R probably damaging Het
Plekha5 A G 6: 140,525,910 Y20C probably damaging Het
Rdh19 A G 10: 127,860,144 D255G probably benign Het
Rgs3 T C 4: 62,631,295 V438A probably benign Het
Rnf186 A G 4: 138,967,943 T265A probably benign Het
Ror1 T C 4: 100,425,998 F420S probably benign Het
Rtkn2 A G 10: 68,005,633 K204E probably damaging Het
Rundc1 A G 11: 101,434,048 T527A probably benign Het
Samd4 T C 14: 47,066,463 S301P probably damaging Het
Scaf1 G A 7: 45,005,879 probably benign Het
Srgap2 A G 1: 131,289,472 V1034A probably benign Het
Stab2 T C 10: 86,942,235 D743G probably damaging Het
Stim1 A T 7: 102,354,572 I71F probably damaging Het
Stk17b T C 1: 53,757,534 D358G probably benign Het
Sun2 A G 15: 79,727,564 Y551H probably damaging Het
Tas2r110 A T 6: 132,868,128 T41S probably benign Het
Tead3 T A 17: 28,333,615 E268V probably damaging Het
Tead3 A G 17: 28,334,988 S131P probably benign Het
Tepsin A T 11: 120,091,525 M505K possibly damaging Het
Trbv29 A G 6: 41,271,734 Y66C possibly damaging Het
Ttc6 A G 12: 57,702,356 Q1358R probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Uaca T C 9: 60,846,001 V76A probably damaging Het
Vwf A T 6: 125,686,462 T2789S probably benign Het
Yipf4 T C 17: 74,494,094 F136L probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp804b A T 5: 6,876,479 D51E probably damaging Het
Zfyve9 C T 4: 108,680,986 G969R probably damaging Het
Other mutations in Adcyap1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Adcyap1r1 APN 6 55472279 missense probably damaging 1.00
IGL00837:Adcyap1r1 APN 6 55461620 splice site probably benign
IGL02686:Adcyap1r1 APN 6 55481125 missense probably benign 0.37
IGL03229:Adcyap1r1 APN 6 55478123 missense probably damaging 1.00
PIT4458001:Adcyap1r1 UTSW 6 55478082 missense probably benign 0.00
R0360:Adcyap1r1 UTSW 6 55475523 intron probably benign
R0517:Adcyap1r1 UTSW 6 55491297 missense probably damaging 0.99
R1169:Adcyap1r1 UTSW 6 55494116 missense probably damaging 1.00
R1897:Adcyap1r1 UTSW 6 55479194 missense probably damaging 1.00
R2113:Adcyap1r1 UTSW 6 55481115 missense probably damaging 0.99
R4462:Adcyap1r1 UTSW 6 55480099 missense possibly damaging 0.90
R5146:Adcyap1r1 UTSW 6 55484972 missense probably benign 0.00
R5341:Adcyap1r1 UTSW 6 55478069 missense probably benign 0.00
R6426:Adcyap1r1 UTSW 6 55494187 missense probably damaging 1.00
R6599:Adcyap1r1 UTSW 6 55479994 missense probably damaging 1.00
R6928:Adcyap1r1 UTSW 6 55479272 missense possibly damaging 0.92
R7059:Adcyap1r1 UTSW 6 55491310 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGTAGAGCTGCACTTCAG -3'
(R):5'- TCCAGCTTCAGACCATCTTG -3'

Sequencing Primer
(F):5'- GTAGAGCTGCACTTCAGGATTTACC -3'
(R):5'- ATTCCTAAGTATAATGGGGGTCCC -3'
Posted On2016-03-17