Incidental Mutation 'R4871:Vwf'
ID376581
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene NameVon Willebrand factor
Synonyms6820430P06Rik, B130011O06Rik
MMRRC Submission 042481-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R4871 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125546774-125686679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125686462 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 2789 (T2789S)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254] [ENSMUST00000160496]
Predicted Effect probably benign
Transcript: ENSMUST00000112254
AA Change: T2789S

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: T2789S

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146264
Predicted Effect probably benign
Transcript: ENSMUST00000147101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159111
Predicted Effect probably benign
Transcript: ENSMUST00000160496
SMART Domains Protein: ENSMUSP00000125303
Gene: ENSMUSG00000038115

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:Anoct_dimer 91 348 5.7e-78 PFAM
Pfam:Anoctamin 351 941 6.7e-138 PFAM
low complexity region 964 991 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 93% (99/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,480,093 T270A probably null Het
Adgrv1 A T 13: 81,533,122 probably benign Het
Aldh1b1 A T 4: 45,803,383 D307V probably benign Het
Aldh3a2 A T 11: 61,262,239 C220* probably null Het
Ank2 T C 3: 126,959,795 Y279C probably damaging Het
Anks1 T C 17: 27,991,377 Y444H probably benign Het
Asph G T 4: 9,531,968 T383K probably benign Het
Asphd1 G T 7: 126,948,575 S185R possibly damaging Het
Bcl2a1d T A 9: 88,731,695 I9F probably damaging Het
Bcl2l11 T C 2: 128,129,041 probably benign Het
C2cd3 T G 7: 100,413,374 S656A possibly damaging Het
Ccdc109b C T 3: 129,917,036 W249* probably null Het
Cd5l T C 3: 87,367,622 V156A probably damaging Het
Cdh8 G C 8: 99,030,904 N687K probably damaging Het
Cdk19 A G 10: 40,476,236 D338G probably benign Het
Cenpf A G 1: 189,658,531 C1035R probably damaging Het
Cep290 A G 10: 100,548,914 R1845G probably benign Het
Cep295nl G T 11: 118,333,824 Q65K probably damaging Het
Ciz1 T C 2: 32,372,288 probably benign Het
Clasrp T C 7: 19,590,248 D234G possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Ddr2 A G 1: 170,004,771 V150A probably benign Het
Dnah7b T C 1: 46,081,444 S74P probably benign Het
Dnttip2 C A 3: 122,285,101 A743E probably damaging Het
Dysf A T 6: 84,067,023 Q281L possibly damaging Het
Ece2 A G 16: 20,644,155 E610G probably damaging Het
Edem3 T G 1: 151,804,231 probably null Het
Ext1 G T 15: 53,092,377 N441K probably benign Het
Fam118a A G 15: 85,058,768 R333G probably damaging Het
Fam45a A G 19: 60,830,814 E120G probably damaging Het
Fat4 C T 3: 38,891,605 T1549I probably damaging Het
Fbxo4 A G 15: 3,975,912 V162A probably damaging Het
Fgd2 A G 17: 29,373,249 H385R possibly damaging Het
Garnl3 A T 2: 33,087,088 M1K probably null Het
Gm37267 T G 1: 180,510,518 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbar1 C T 1: 74,279,543 A315V probably damaging Het
Grm2 T C 9: 106,647,645 I624V probably benign Het
Hmcn1 T C 1: 150,593,085 I5042V probably benign Het
Hnf4g T C 3: 3,651,388 Y291H possibly damaging Het
Ighm A G 12: 113,421,621 S240P unknown Het
Igkv4-91 A G 6: 68,768,620 I98T probably damaging Het
Krt72 T C 15: 101,786,034 N142S probably damaging Het
Kynu T A 2: 43,679,818 Y371N possibly damaging Het
Ly9 G T 1: 171,607,330 probably benign Het
Man1a2 C A 3: 100,617,056 V359F probably damaging Het
Mast1 T C 8: 84,920,658 I623M probably damaging Het
Mb A G 15: 77,022,487 probably null Het
Mcm4 A C 16: 15,634,510 L113* probably null Het
Mme T A 3: 63,340,032 V246E probably benign Het
Mrpl38 A G 11: 116,134,272 Y232H probably damaging Het
Myh7b T A 2: 155,613,500 M89K probably benign Het
Notch4 A G 17: 34,577,562 S892G possibly damaging Het
Nt5dc3 A G 10: 86,817,077 Y245C probably damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr101 T A 17: 37,300,204 T73S probably benign Het
Olfr1024 T A 2: 85,904,371 I228F probably benign Het
Olfr104-ps A T 17: 37,362,446 I107L probably benign Het
Olfr1066 A T 2: 86,455,809 I154N possibly damaging Het
Olfr305 A T 7: 86,363,484 N284K probably damaging Het
Olfr883 G T 9: 38,026,526 C240F probably damaging Het
Palld A T 8: 61,549,781 probably benign Het
Pcdhga10 T C 18: 37,748,200 V338A probably damaging Het
Pcdhga11 A G 18: 37,757,406 Y489C probably damaging Het
Pgm1 T C 5: 64,103,894 Y244H probably benign Het
Phactr4 A T 4: 132,378,448 S102R probably damaging Het
Plekha5 A G 6: 140,525,910 Y20C probably damaging Het
Rdh19 A G 10: 127,860,144 D255G probably benign Het
Rgs3 T C 4: 62,631,295 V438A probably benign Het
Rnf186 A G 4: 138,967,943 T265A probably benign Het
Ror1 T C 4: 100,425,998 F420S probably benign Het
Rtkn2 A G 10: 68,005,633 K204E probably damaging Het
Rundc1 A G 11: 101,434,048 T527A probably benign Het
Samd4 T C 14: 47,066,463 S301P probably damaging Het
Scaf1 G A 7: 45,005,879 probably benign Het
Srgap2 A G 1: 131,289,472 V1034A probably benign Het
Stab2 T C 10: 86,942,235 D743G probably damaging Het
Stim1 A T 7: 102,354,572 I71F probably damaging Het
Stk17b T C 1: 53,757,534 D358G probably benign Het
Sun2 A G 15: 79,727,564 Y551H probably damaging Het
Tas2r110 A T 6: 132,868,128 T41S probably benign Het
Tead3 A G 17: 28,334,988 S131P probably benign Het
Tead3 T A 17: 28,333,615 E268V probably damaging Het
Tepsin A T 11: 120,091,525 M505K possibly damaging Het
Trbv29 A G 6: 41,271,734 Y66C possibly damaging Het
Ttc6 A G 12: 57,702,356 Q1358R probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Uaca T C 9: 60,846,001 V76A probably damaging Het
Yipf4 T C 17: 74,494,094 F136L probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp804b A T 5: 6,876,479 D51E probably damaging Het
Zfyve9 C T 4: 108,680,986 G969R probably damaging Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- TATAGGTTGTCCCAGAATCCTGC -3'
(R):5'- CCAGCCTTGGTTAAGATGAGAAC -3'

Sequencing Primer
(F):5'- AGAATCCTGCTGCCCCATC -3'
(R):5'- CCTTGGTTAAGATGAGAACTTGGCC -3'
Posted On2016-03-17