Mutagenetix > Incidental Mutations

Incidental Mutation 'R4871:Stim1'

376588

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

042481-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4871 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102354572 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 71 (I71F)

Ref Sequence

ENSEMBL: ENSMUSP00000147410 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033289
AA Change: I71F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: I71F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000209255
AA Change: I71F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210266

Predicted Effect

probably damaging
Transcript: ENSMUST00000211457
AA Change: I71F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6492

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

93% (99/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcyap1r1	A	G	6: 55,480,093	T270A	probably null	Het
Adgrv1	A	T	13: 81,533,122		probably benign	Het
Aldh1b1	A	T	4: 45,803,383	D307V	probably benign	Het
Aldh3a2	A	T	11: 61,262,239	C220*	probably null	Het
Ank2	T	C	3: 126,959,795	Y279C	probably damaging	Het
Anks1	T	C	17: 27,991,377	Y444H	probably benign	Het
Asph	G	T	4: 9,531,968	T383K	probably benign	Het
Asphd1	G	T	7: 126,948,575	S185R	possibly damaging	Het
Bcl2a1d	T	A	9: 88,731,695	I9F	probably damaging	Het
Bcl2l11	T	C	2: 128,129,041		probably benign	Het
C2cd3	T	G	7: 100,413,374	S656A	possibly damaging	Het
Ccdc109b	C	T	3: 129,917,036	W249*	probably null	Het
Cd5l	T	C	3: 87,367,622	V156A	probably damaging	Het
Cdh8	G	C	8: 99,030,904	N687K	probably damaging	Het
Cdk19	A	G	10: 40,476,236	D338G	probably benign	Het
Cenpf	A	G	1: 189,658,531	C1035R	probably damaging	Het
Cep290	A	G	10: 100,548,914	R1845G	probably benign	Het
Cep295nl	G	T	11: 118,333,824	Q65K	probably damaging	Het
Ciz1	T	C	2: 32,372,288		probably benign	Het
Clasrp	T	C	7: 19,590,248	D234G	possibly damaging	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Ddr2	A	G	1: 170,004,771	V150A	probably benign	Het
Dnah7b	T	C	1: 46,081,444	S74P	probably benign	Het
Dnttip2	C	A	3: 122,285,101	A743E	probably damaging	Het
Dysf	A	T	6: 84,067,023	Q281L	possibly damaging	Het
Ece2	A	G	16: 20,644,155	E610G	probably damaging	Het
Edem3	T	G	1: 151,804,231		probably null	Het
Ext1	G	T	15: 53,092,377	N441K	probably benign	Het
Fam118a	A	G	15: 85,058,768	R333G	probably damaging	Het
Fam45a	A	G	19: 60,830,814	E120G	probably damaging	Het
Fat4	C	T	3: 38,891,605	T1549I	probably damaging	Het
Fbxo4	A	G	15: 3,975,912	V162A	probably damaging	Het
Fgd2	A	G	17: 29,373,249	H385R	possibly damaging	Het
Garnl3	A	T	2: 33,087,088	M1K	probably null	Het
Gm37267	T	G	1: 180,510,518		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpbar1	C	T	1: 74,279,543	A315V	probably damaging	Het
Grm2	T	C	9: 106,647,645	I624V	probably benign	Het
Hmcn1	T	C	1: 150,593,085	I5042V	probably benign	Het
Hnf4g	T	C	3: 3,651,388	Y291H	possibly damaging	Het
Ighm	A	G	12: 113,421,621	S240P	unknown	Het
Igkv4-91	A	G	6: 68,768,620	I98T	probably damaging	Het
Krt72	T	C	15: 101,786,034	N142S	probably damaging	Het
Kynu	T	A	2: 43,679,818	Y371N	possibly damaging	Het
Ly9	G	T	1: 171,607,330		probably benign	Het
Man1a2	C	A	3: 100,617,056	V359F	probably damaging	Het
Mast1	T	C	8: 84,920,658	I623M	probably damaging	Het
Mb	A	G	15: 77,022,487		probably null	Het
Mcm4	A	C	16: 15,634,510	L113*	probably null	Het
Mme	T	A	3: 63,340,032	V246E	probably benign	Het
Mrpl38	A	G	11: 116,134,272	Y232H	probably damaging	Het
Myh7b	T	A	2: 155,613,500	M89K	probably benign	Het
Notch4	A	G	17: 34,577,562	S892G	possibly damaging	Het
Nt5dc3	A	G	10: 86,817,077	Y245C	probably damaging	Het
Ntn1	CCTTCTTCT	CCTTCT	11: 68,213,026		probably benign	Het
Olfr101	T	A	17: 37,300,204	T73S	probably benign	Het
Olfr1024	T	A	2: 85,904,371	I228F	probably benign	Het
Olfr104-ps	A	T	17: 37,362,446	I107L	probably benign	Het
Olfr1066	A	T	2: 86,455,809	I154N	possibly damaging	Het
Olfr305	A	T	7: 86,363,484	N284K	probably damaging	Het
Olfr883	G	T	9: 38,026,526	C240F	probably damaging	Het
Palld	A	T	8: 61,549,781		probably benign	Het
Pcdhga10	T	C	18: 37,748,200	V338A	probably damaging	Het
Pcdhga11	A	G	18: 37,757,406	Y489C	probably damaging	Het
Pgm1	T	C	5: 64,103,894	Y244H	probably benign	Het
Phactr4	A	T	4: 132,378,448	S102R	probably damaging	Het
Plekha5	A	G	6: 140,525,910	Y20C	probably damaging	Het
Rdh19	A	G	10: 127,860,144	D255G	probably benign	Het
Rgs3	T	C	4: 62,631,295	V438A	probably benign	Het
Rnf186	A	G	4: 138,967,943	T265A	probably benign	Het
Ror1	T	C	4: 100,425,998	F420S	probably benign	Het
Rtkn2	A	G	10: 68,005,633	K204E	probably damaging	Het
Rundc1	A	G	11: 101,434,048	T527A	probably benign	Het
Samd4	T	C	14: 47,066,463	S301P	probably damaging	Het
Scaf1	G	A	7: 45,005,879		probably benign	Het
Srgap2	A	G	1: 131,289,472	V1034A	probably benign	Het
Stab2	T	C	10: 86,942,235	D743G	probably damaging	Het
Stk17b	T	C	1: 53,757,534	D358G	probably benign	Het
Sun2	A	G	15: 79,727,564	Y551H	probably damaging	Het
Tas2r110	A	T	6: 132,868,128	T41S	probably benign	Het
Tead3	T	A	17: 28,333,615	E268V	probably damaging	Het
Tead3	A	G	17: 28,334,988	S131P	probably benign	Het
Tepsin	A	T	11: 120,091,525	M505K	possibly damaging	Het
Trbv29	A	G	6: 41,271,734	Y66C	possibly damaging	Het
Ttc6	A	G	12: 57,702,356	Q1358R	probably damaging	Het
Ttll2	C	T	17: 7,351,599	V310I	probably benign	Het
Uaca	T	C	9: 60,846,001	V76A	probably damaging	Het
Vwf	A	T	6: 125,686,462	T2789S	probably benign	Het
Yipf4	T	C	17: 74,494,094	F136L	probably benign	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfp804b	A	T	5: 6,876,479	D51E	probably damaging	Het
Zfyve9	C	T	4: 108,680,986	G969R	probably damaging	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1643:Stim1	UTSW	7	102386100	missense	possibly damaging	0.92
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R3940:Stim1	UTSW	7	102435641	missense	probably benign	0.00
R4820:Stim1	UTSW	7	102415364	missense	probably damaging	0.97
R5110:Stim1	UTSW	7	102268422	missense	unknown
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R6788:Stim1	UTSW	7	102427291	missense	probably damaging	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7650:Stim1	UTSW	7	102428827	missense
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- AATGCTTCTATGAGGAGTCAGG -3'
(R):5'- CAAACGGAGACCTGTTCTGC -3'

Sequencing Primer
(F):5'- GAACTGGAAGCTAAGATTGCTGACAC -3'
(R):5'- AGACCTGTTCTGCTGGGCATC -3'

Posted On

2016-03-17