Incidental Mutation 'R4871:Ece2'
ID376621
Institutional Source Beutler Lab
Gene Symbol Ece2
Ensembl Gene ENSMUSG00000022842
Gene Nameendothelin converting enzyme 2
Synonyms1810009K13Rik, 9630025D12Rik, 6330509A19Rik
MMRRC Submission 042481-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4871 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20629828-20646485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20644155 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 610 (E610G)
Ref Sequence ENSEMBL: ENSMUSP00000119693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003898] [ENSMUST00000079600] [ENSMUST00000120394] [ENSMUST00000122306] [ENSMUST00000133344]
Predicted Effect probably benign
Transcript: ENSMUST00000003898
AA Change: E639G

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000003898
Gene: ENSMUSG00000022842
AA Change: E639G

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Peptidase_M13_N 115 500 8.3e-125 PFAM
Pfam:Peptidase_M13 559 762 1.1e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079600
AA Change: E757G

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078550
Gene: ENSMUSG00000115293
AA Change: E757G

DomainStartEndE-ValueType
Pfam:Methyltransf_11 63 158 8.5e-8 PFAM
transmembrane domain 179 201 N/A INTRINSIC
Pfam:Peptidase_M13_N 233 618 1.2e-124 PFAM
Pfam:Peptidase_M13 677 880 1.4e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120394
AA Change: E786G

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113475
Gene: ENSMUSG00000115293
AA Change: E786G

DomainStartEndE-ValueType
Pfam:Methyltransf_18 58 163 1.2e-8 PFAM
Pfam:Methyltransf_11 63 163 1.7e-9 PFAM
transmembrane domain 208 230 N/A INTRINSIC
Pfam:Peptidase_M13_N 262 647 5e-109 PFAM
Pfam:Peptidase_M13 706 909 9.4e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122306
AA Change: E639G

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114039
Gene: ENSMUSG00000022842
AA Change: E639G

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Peptidase_M13_N 115 500 6.9e-125 PFAM
Pfam:Peptidase_M13 559 709 6e-50 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000125971
AA Change: E399G
SMART Domains Protein: ENSMUSP00000120239
Gene: ENSMUSG00000022842
AA Change: E399G

DomainStartEndE-ValueType
Pfam:Peptidase_M13_N 1 261 1.3e-71 PFAM
Pfam:Peptidase_M13 320 482 3.4e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133344
AA Change: E610G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119693
Gene: ENSMUSG00000022842
AA Change: E610G

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:Peptidase_M13_N 86 471 7.5e-125 PFAM
Pfam:Peptidase_M13 530 733 1e-66 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121231
Gene: ENSMUSG00000022842
AA Change: E700G

DomainStartEndE-ValueType
Pfam:Methyltransf_18 2 105 1.1e-8 PFAM
Pfam:Methyltransf_11 7 103 1.7e-9 PFAM
transmembrane domain 123 145 N/A INTRINSIC
Pfam:Peptidase_M13_N 177 562 4e-109 PFAM
Pfam:Peptidase_M13 621 824 8e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231739
Meta Mutation Damage Score 0.1484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 93% (99/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M13 family, which includes type 2 integral membrane metallopeptidases. The encoded enzyme is a membrane-bound zinc-dependent metalloprotease. The enzyme catalyzes the cleavage of big endothelin to produce the vasoconstrictor endothelin-1, and plays a role in the processing of several neuroendocrine peptides. It may also have methyltransferase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice develop normally, are viable and healthy, and exhibit normal fertility in both sexes, as well as a normal life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,480,093 T270A probably null Het
Adgrv1 A T 13: 81,533,122 probably benign Het
Aldh1b1 A T 4: 45,803,383 D307V probably benign Het
Aldh3a2 A T 11: 61,262,239 C220* probably null Het
Ank2 T C 3: 126,959,795 Y279C probably damaging Het
Anks1 T C 17: 27,991,377 Y444H probably benign Het
Asph G T 4: 9,531,968 T383K probably benign Het
Asphd1 G T 7: 126,948,575 S185R possibly damaging Het
Bcl2a1d T A 9: 88,731,695 I9F probably damaging Het
Bcl2l11 T C 2: 128,129,041 probably benign Het
C2cd3 T G 7: 100,413,374 S656A possibly damaging Het
Ccdc109b C T 3: 129,917,036 W249* probably null Het
Cd5l T C 3: 87,367,622 V156A probably damaging Het
Cdh8 G C 8: 99,030,904 N687K probably damaging Het
Cdk19 A G 10: 40,476,236 D338G probably benign Het
Cenpf A G 1: 189,658,531 C1035R probably damaging Het
Cep290 A G 10: 100,548,914 R1845G probably benign Het
Cep295nl G T 11: 118,333,824 Q65K probably damaging Het
Ciz1 T C 2: 32,372,288 probably benign Het
Clasrp T C 7: 19,590,248 D234G possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Ddr2 A G 1: 170,004,771 V150A probably benign Het
Dnah7b T C 1: 46,081,444 S74P probably benign Het
Dnttip2 C A 3: 122,285,101 A743E probably damaging Het
Dysf A T 6: 84,067,023 Q281L possibly damaging Het
Edem3 T G 1: 151,804,231 probably null Het
Ext1 G T 15: 53,092,377 N441K probably benign Het
Fam118a A G 15: 85,058,768 R333G probably damaging Het
Fam45a A G 19: 60,830,814 E120G probably damaging Het
Fat4 C T 3: 38,891,605 T1549I probably damaging Het
Fbxo4 A G 15: 3,975,912 V162A probably damaging Het
Fgd2 A G 17: 29,373,249 H385R possibly damaging Het
Garnl3 A T 2: 33,087,088 M1K probably null Het
Gm37267 T G 1: 180,510,518 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbar1 C T 1: 74,279,543 A315V probably damaging Het
Grm2 T C 9: 106,647,645 I624V probably benign Het
Hmcn1 T C 1: 150,593,085 I5042V probably benign Het
Hnf4g T C 3: 3,651,388 Y291H possibly damaging Het
Ighm A G 12: 113,421,621 S240P unknown Het
Igkv4-91 A G 6: 68,768,620 I98T probably damaging Het
Krt72 T C 15: 101,786,034 N142S probably damaging Het
Kynu T A 2: 43,679,818 Y371N possibly damaging Het
Ly9 G T 1: 171,607,330 probably benign Het
Man1a2 C A 3: 100,617,056 V359F probably damaging Het
Mast1 T C 8: 84,920,658 I623M probably damaging Het
Mb A G 15: 77,022,487 probably null Het
Mcm4 A C 16: 15,634,510 L113* probably null Het
Mme T A 3: 63,340,032 V246E probably benign Het
Mrpl38 A G 11: 116,134,272 Y232H probably damaging Het
Myh7b T A 2: 155,613,500 M89K probably benign Het
Notch4 A G 17: 34,577,562 S892G possibly damaging Het
Nt5dc3 A G 10: 86,817,077 Y245C probably damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr101 T A 17: 37,300,204 T73S probably benign Het
Olfr1024 T A 2: 85,904,371 I228F probably benign Het
Olfr104-ps A T 17: 37,362,446 I107L probably benign Het
Olfr1066 A T 2: 86,455,809 I154N possibly damaging Het
Olfr305 A T 7: 86,363,484 N284K probably damaging Het
Olfr883 G T 9: 38,026,526 C240F probably damaging Het
Palld A T 8: 61,549,781 probably benign Het
Pcdhga10 T C 18: 37,748,200 V338A probably damaging Het
Pcdhga11 A G 18: 37,757,406 Y489C probably damaging Het
Pgm1 T C 5: 64,103,894 Y244H probably benign Het
Phactr4 A T 4: 132,378,448 S102R probably damaging Het
Plekha5 A G 6: 140,525,910 Y20C probably damaging Het
Rdh19 A G 10: 127,860,144 D255G probably benign Het
Rgs3 T C 4: 62,631,295 V438A probably benign Het
Rnf186 A G 4: 138,967,943 T265A probably benign Het
Ror1 T C 4: 100,425,998 F420S probably benign Het
Rtkn2 A G 10: 68,005,633 K204E probably damaging Het
Rundc1 A G 11: 101,434,048 T527A probably benign Het
Samd4 T C 14: 47,066,463 S301P probably damaging Het
Scaf1 G A 7: 45,005,879 probably benign Het
Srgap2 A G 1: 131,289,472 V1034A probably benign Het
Stab2 T C 10: 86,942,235 D743G probably damaging Het
Stim1 A T 7: 102,354,572 I71F probably damaging Het
Stk17b T C 1: 53,757,534 D358G probably benign Het
Sun2 A G 15: 79,727,564 Y551H probably damaging Het
Tas2r110 A T 6: 132,868,128 T41S probably benign Het
Tead3 T A 17: 28,333,615 E268V probably damaging Het
Tead3 A G 17: 28,334,988 S131P probably benign Het
Tepsin A T 11: 120,091,525 M505K possibly damaging Het
Trbv29 A G 6: 41,271,734 Y66C possibly damaging Het
Ttc6 A G 12: 57,702,356 Q1358R probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Uaca T C 9: 60,846,001 V76A probably damaging Het
Vwf A T 6: 125,686,462 T2789S probably benign Het
Yipf4 T C 17: 74,494,094 F136L probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp804b A T 5: 6,876,479 D51E probably damaging Het
Zfyve9 C T 4: 108,680,986 G969R probably damaging Het
Other mutations in Ece2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Ece2 APN 16 20632794 missense possibly damaging 0.88
IGL01644:Ece2 APN 16 20617866 missense possibly damaging 0.93
IGL02414:Ece2 APN 16 20640706 missense probably damaging 1.00
IGL02754:Ece2 APN 16 20632648 missense probably damaging 1.00
IGL03368:Ece2 APN 16 20644158 missense possibly damaging 0.95
IGL03383:Ece2 APN 16 20633097 missense possibly damaging 0.90
R0063:Ece2 UTSW 16 20642317 missense probably benign
R0063:Ece2 UTSW 16 20642317 missense probably benign
R0750:Ece2 UTSW 16 20633050 missense probably benign 0.00
R1304:Ece2 UTSW 16 20611782 missense probably damaging 1.00
R1500:Ece2 UTSW 16 20644242 missense probably damaging 1.00
R1539:Ece2 UTSW 16 20642513 missense probably damaging 1.00
R1667:Ece2 UTSW 16 20637838 missense possibly damaging 0.78
R1702:Ece2 UTSW 16 20631246 missense probably damaging 0.99
R1903:Ece2 UTSW 16 20645172 missense probably damaging 0.99
R1937:Ece2 UTSW 16 20617866 missense probably damaging 0.99
R2014:Ece2 UTSW 16 20642317 missense probably benign
R4393:Ece2 UTSW 16 20632848 missense probably damaging 1.00
R4678:Ece2 UTSW 16 20640718 missense probably damaging 1.00
R4839:Ece2 UTSW 16 20631168 missense probably damaging 1.00
R4857:Ece2 UTSW 16 20617806 missense probably damaging 1.00
R4903:Ece2 UTSW 16 20631222 nonsense probably null
R4914:Ece2 UTSW 16 20644070 missense probably damaging 1.00
R5119:Ece2 UTSW 16 20618631 missense probably damaging 0.98
R5218:Ece2 UTSW 16 20618540 missense probably benign 0.06
R5642:Ece2 UTSW 16 20643727 missense probably benign 0.42
R5911:Ece2 UTSW 16 20638760 missense probably damaging 1.00
R6037:Ece2 UTSW 16 20630362 missense probably damaging 1.00
R6037:Ece2 UTSW 16 20630362 missense probably damaging 1.00
R6253:Ece2 UTSW 16 20639182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCATTCTAGAATTCCCAG -3'
(R):5'- TAACAGGTAGCAAGTCCACCAG -3'

Sequencing Primer
(F):5'- CCCAGTGACTACTACAGTGATATGG -3'
(R):5'- TAGCAAGTCCACCAGCCCAC -3'
Posted On2016-03-17