Incidental Mutation 'R0295:Knl1'
ID37663
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission 038512-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0295 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119088839 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1824 (D1824A)
Ref Sequence ENSEMBL: ENSMUSP00000097140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028802] [ENSMUST00000099542]
Predicted Effect probably damaging
Transcript: ENSMUST00000028802
AA Change: D1824A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: D1824A

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000099542
AA Change: D1824A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: D1824A

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Meta Mutation Damage Score 0.1209 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,282,594 I173N probably damaging Het
2610028H24Rik G A 10: 76,454,808 S127N probably damaging Het
Abcc8 T C 7: 46,118,054 R953G probably benign Het
Adamtsl3 T A 7: 82,548,005 probably null Het
Adh4 A G 3: 138,429,076 D337G probably damaging Het
Apob T A 12: 8,002,181 Y1207* probably null Het
Birc6 T C 17: 74,613,362 probably benign Het
Bms1 A G 6: 118,389,337 I1065T probably benign Het
Cacna1i T A 15: 80,356,211 L378Q probably damaging Het
Ccdc127 C A 13: 74,356,870 P179H probably damaging Het
Ccdc18 A T 5: 108,173,789 K586N probably damaging Het
Cep290 A C 10: 100,537,821 E1321A probably damaging Het
Ctc1 A G 11: 69,030,588 K682E possibly damaging Het
Cux1 A C 5: 136,313,212 V442G probably benign Het
Dph2 A T 4: 117,890,930 V150E possibly damaging Het
Etv6 A G 6: 134,266,275 D331G probably benign Het
Fbxo42 A G 4: 141,200,497 D696G probably damaging Het
Fbxo8 G A 8: 56,590,074 D198N probably benign Het
Gria4 T C 9: 4,793,840 T73A possibly damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Ifng G T 10: 118,441,249 S32I possibly damaging Het
Ildr1 A G 16: 36,709,477 probably null Het
Lamp3 A T 16: 19,701,108 Y108* probably null Het
Lcp1 A G 14: 75,199,420 I69V probably null Het
Lrp6 A T 6: 134,457,693 V1349E probably benign Het
Lrrcc1 A T 3: 14,565,849 E1009D probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Med14 G C X: 12,685,748 R1223G probably damaging Het
Mesd C T 7: 83,897,865 Q179* probably null Het
Myh7 A G 14: 54,984,821 probably benign Het
Myo6 T C 9: 80,283,579 I804T probably damaging Het
Neb T C 2: 52,284,285 I1521V possibly damaging Het
Nosip T A 7: 45,076,916 I249N probably damaging Het
Nostrin A C 2: 69,179,416 E296A probably benign Het
Olfr1280 T A 2: 111,316,154 V225D probably damaging Het
Olfr136 A T 17: 38,335,291 I45F probably damaging Het
Olfr491 T G 7: 108,317,685 S264A probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Oprk1 T C 1: 5,598,850 L173S possibly damaging Het
Pdzd7 A G 19: 45,037,072 V328A probably benign Het
Podxl2 A T 6: 88,849,678 S215R probably benign Het
Prss36 T G 7: 127,935,855 T418P possibly damaging Het
Ralgps2 T A 1: 156,823,985 probably benign Het
Rasa2 T C 9: 96,545,810 probably null Het
Rgs1 A T 1: 144,245,486 I149N probably damaging Het
Rgs16 A G 1: 153,743,737 E163G probably damaging Het
Rnf121 A G 7: 102,035,346 F120S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slfn8 A T 11: 83,003,343 Y823* probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
St6gal1 T A 16: 23,356,203 probably benign Het
Tet3 G A 6: 83,369,139 P1304S probably benign Het
Timm29 T C 9: 21,593,076 probably null Het
Tpcn1 T A 5: 120,539,060 I687F probably damaging Het
Trim46 A G 3: 89,245,113 probably benign Het
Ttc23 T A 7: 67,669,852 probably benign Het
Ttll6 G T 11: 96,154,714 V586L probably benign Het
Ttn A T 2: 76,758,611 probably benign Het
Uba3 A T 6: 97,191,583 H160Q possibly damaging Het
Usp32 A G 11: 85,053,692 S316P probably damaging Het
Vcan T C 13: 89,712,191 I352M probably benign Het
Zcwpw1 G T 5: 137,817,472 L412F probably damaging Het
Zfp292 A T 4: 34,806,281 N2254K probably damaging Het
Zscan4e A G 7: 11,307,616 S138P probably damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
R8423:Knl1 UTSW 2 119070032 missense probably damaging 1.00
R8725:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8727:Knl1 UTSW 2 119069043 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCCTGTGTCCATCTGATCACAGAAAA -3'
(R):5'- AGCTGCTAAGACAGCATAGTAAGACCA -3'

Sequencing Primer
(F):5'- cacaagttcagcatcagcc -3'
(R):5'- GACAGCATAGTAAGACCAAACTTTC -3'
Posted On2013-05-23