Incidental Mutation 'R0295:Adh4'
ID37665
Institutional Source Beutler Lab
Gene Symbol Adh4
Ensembl Gene ENSMUSG00000037797
Gene Namealcohol dehydrogenase 4 (class II), pi polypeptide
SynonymsAdh2, mouse class II type ADH
MMRRC Submission 038512-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0295 (G1)
Quality Score160
Status Validated
Chromosome3
Chromosomal Location138415466-138430892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138429076 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 337 (D337G)
Ref Sequence ENSEMBL: ENSMUSP00000013458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013458]
PDB Structure
Mouse class II alcohol dehydrogenase complex with NADH [X-RAY DIFFRACTION]
Mouse class II alcohol dehydrogenase complex with NADH and inhibitor [X-RAY DIFFRACTION]
P47H MUTANT OF MOUSE CLASS II ALCOHOL DEHYDROGENASE COMPLEX WITH NADH [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000013458
AA Change: D337G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013458
Gene: ENSMUSG00000037797
AA Change: D337G

DomainStartEndE-ValueType
Pfam:ADH_N 34 165 3.1e-23 PFAM
Pfam:ADH_zinc_N 207 337 8.2e-24 PFAM
Meta Mutation Damage Score 0.3446 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class II alcohol dehydrogenase 4 pi subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class II alcohol dehydrogenase is a homodimer composed of 2 pi subunits. It exhibits a high activity for oxidation of long-chain aliphatic alcohols and aromatic alcohols and is less sensitive to pyrazole. This gene is localized to chromosome 4 in the cluster of alcohol dehydrogenase genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,282,594 I173N probably damaging Het
2610028H24Rik G A 10: 76,454,808 S127N probably damaging Het
Abcc8 T C 7: 46,118,054 R953G probably benign Het
Adamtsl3 T A 7: 82,548,005 probably null Het
Apob T A 12: 8,002,181 Y1207* probably null Het
Birc6 T C 17: 74,613,362 probably benign Het
Bms1 A G 6: 118,389,337 I1065T probably benign Het
Cacna1i T A 15: 80,356,211 L378Q probably damaging Het
Ccdc127 C A 13: 74,356,870 P179H probably damaging Het
Ccdc18 A T 5: 108,173,789 K586N probably damaging Het
Cep290 A C 10: 100,537,821 E1321A probably damaging Het
Ctc1 A G 11: 69,030,588 K682E possibly damaging Het
Cux1 A C 5: 136,313,212 V442G probably benign Het
Dph2 A T 4: 117,890,930 V150E possibly damaging Het
Etv6 A G 6: 134,266,275 D331G probably benign Het
Fbxo42 A G 4: 141,200,497 D696G probably damaging Het
Fbxo8 G A 8: 56,590,074 D198N probably benign Het
Gria4 T C 9: 4,793,840 T73A possibly damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Ifng G T 10: 118,441,249 S32I possibly damaging Het
Ildr1 A G 16: 36,709,477 probably null Het
Knl1 A C 2: 119,088,839 D1824A probably damaging Het
Lamp3 A T 16: 19,701,108 Y108* probably null Het
Lcp1 A G 14: 75,199,420 I69V probably null Het
Lrp6 A T 6: 134,457,693 V1349E probably benign Het
Lrrcc1 A T 3: 14,565,849 E1009D probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Med14 G C X: 12,685,748 R1223G probably damaging Het
Mesd C T 7: 83,897,865 Q179* probably null Het
Myh7 A G 14: 54,984,821 probably benign Het
Myo6 T C 9: 80,283,579 I804T probably damaging Het
Neb T C 2: 52,284,285 I1521V possibly damaging Het
Nosip T A 7: 45,076,916 I249N probably damaging Het
Nostrin A C 2: 69,179,416 E296A probably benign Het
Olfr1280 T A 2: 111,316,154 V225D probably damaging Het
Olfr136 A T 17: 38,335,291 I45F probably damaging Het
Olfr491 T G 7: 108,317,685 S264A probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Oprk1 T C 1: 5,598,850 L173S possibly damaging Het
Pdzd7 A G 19: 45,037,072 V328A probably benign Het
Podxl2 A T 6: 88,849,678 S215R probably benign Het
Prss36 T G 7: 127,935,855 T418P possibly damaging Het
Ralgps2 T A 1: 156,823,985 probably benign Het
Rasa2 T C 9: 96,545,810 probably null Het
Rgs1 A T 1: 144,245,486 I149N probably damaging Het
Rgs16 A G 1: 153,743,737 E163G probably damaging Het
Rnf121 A G 7: 102,035,346 F120S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slfn8 A T 11: 83,003,343 Y823* probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
St6gal1 T A 16: 23,356,203 probably benign Het
Tet3 G A 6: 83,369,139 P1304S probably benign Het
Timm29 T C 9: 21,593,076 probably null Het
Tpcn1 T A 5: 120,539,060 I687F probably damaging Het
Trim46 A G 3: 89,245,113 probably benign Het
Ttc23 T A 7: 67,669,852 probably benign Het
Ttll6 G T 11: 96,154,714 V586L probably benign Het
Ttn A T 2: 76,758,611 probably benign Het
Uba3 A T 6: 97,191,583 H160Q possibly damaging Het
Usp32 A G 11: 85,053,692 S316P probably damaging Het
Vcan T C 13: 89,712,191 I352M probably benign Het
Zcwpw1 G T 5: 137,817,472 L412F probably damaging Het
Zfp292 A T 4: 34,806,281 N2254K probably damaging Het
Zscan4e A G 7: 11,307,616 S138P probably damaging Het
Other mutations in Adh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Adh4 APN 3 138420636 missense probably damaging 0.99
IGL01450:Adh4 APN 3 138424033 missense probably benign 0.05
IGL01608:Adh4 APN 3 138429027 unclassified probably benign
IGL01618:Adh4 APN 3 138429027 unclassified probably benign
IGL01621:Adh4 APN 3 138429027 unclassified probably benign
IGL01640:Adh4 APN 3 138429027 unclassified probably benign
IGL01979:Adh4 APN 3 138429027 unclassified probably benign
IGL01982:Adh4 APN 3 138429027 unclassified probably benign
IGL01993:Adh4 APN 3 138429027 unclassified probably benign
IGL02720:Adh4 APN 3 138419220 missense possibly damaging 0.87
IGL03030:Adh4 APN 3 138429145 missense probably benign 0.13
PIT4403001:Adh4 UTSW 3 138424178 missense probably damaging 0.97
R0308:Adh4 UTSW 3 138424102 missense probably damaging 1.00
R0636:Adh4 UTSW 3 138428074 missense probably damaging 1.00
R1450:Adh4 UTSW 3 138424174 missense probably damaging 1.00
R4824:Adh4 UTSW 3 138429046 missense possibly damaging 0.81
R5137:Adh4 UTSW 3 138422235 missense probably benign 0.00
R5263:Adh4 UTSW 3 138428055 missense probably benign 0.00
R5566:Adh4 UTSW 3 138424189 missense probably damaging 1.00
R6162:Adh4 UTSW 3 138415489 unclassified probably null
R7297:Adh4 UTSW 3 138429140 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTACATTAAGCACACGTATGAATGCCA -3'
(R):5'- CCAGGGAACCTACCCTTCATTACACTA -3'

Sequencing Primer
(F):5'- GTGGCCAAATTACAGGTTGG -3'
(R):5'- caaaaaaccaaaacaaacaaacaaac -3'
Posted On2013-05-23