Incidental Mutation 'R4872:Vmn2r78'
ID 376659
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission 042482-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R4872 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 86564557-86604385 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86603916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 698 (I698K)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect possibly damaging
Transcript: ENSMUST00000170835
AA Change: I698K

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: I698K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 C A 15: 91,075,514 (GRCm39) V100L probably benign Het
Acad11 G A 9: 103,963,465 (GRCm39) probably benign Het
Actb C T 5: 142,891,307 (GRCm39) probably benign Het
Ano9 G A 7: 140,687,117 (GRCm39) A374V probably damaging Het
Baz2b T C 2: 59,773,103 (GRCm39) probably null Het
Bltp3a G T 17: 28,109,110 (GRCm39) D1110Y probably benign Het
Bpifb9b T A 2: 154,155,551 (GRCm39) L350Q probably damaging Het
Cd27 T A 6: 125,211,281 (GRCm39) probably null Het
Cd72 A G 4: 43,449,563 (GRCm39) probably benign Het
Cdadc1 A T 14: 59,801,973 (GRCm39) S516T probably benign Het
Chst5 T A 8: 112,617,192 (GRCm39) I143F possibly damaging Het
Col20a1 T C 2: 180,639,156 (GRCm39) V452A possibly damaging Het
Cox11 C A 11: 90,535,229 (GRCm39) Q227K probably benign Het
Cpa6 A G 1: 10,665,843 (GRCm39) probably null Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dpm2 T C 2: 32,461,203 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Frem1 A C 4: 82,881,387 (GRCm39) N1273K probably damaging Het
Fry T C 5: 150,317,704 (GRCm39) probably null Het
Gm10306 G T 4: 94,445,069 (GRCm39) probably benign Het
Gm5565 T C 5: 146,094,913 (GRCm39) T278A probably benign Het
Gm8180 A G 14: 44,019,802 (GRCm39) I40T probably benign Het
Iah1 T C 12: 21,367,426 (GRCm39) V44A probably benign Het
Iqgap3 C T 3: 88,020,435 (GRCm39) P360S probably damaging Het
Klhl28 T A 12: 65,003,896 (GRCm39) I206F possibly damaging Het
Krt13 A G 11: 100,012,332 (GRCm39) probably benign Het
Lipo2 T A 19: 33,726,914 (GRCm39) D41V probably benign Het
Lrig2 C G 3: 104,398,842 (GRCm39) V229L possibly damaging Het
Lrrc32 C T 7: 98,147,727 (GRCm39) T169I probably damaging Het
Lrriq1 T C 10: 103,014,649 (GRCm39) N1053S possibly damaging Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Mgat4c G C 10: 102,224,599 (GRCm39) R271P probably damaging Het
Mylk A G 16: 34,735,360 (GRCm39) N780S possibly damaging Het
N4bp1 T C 8: 87,587,676 (GRCm39) T421A probably benign Het
Nat8f1 T C 6: 85,887,295 (GRCm39) T222A probably benign Het
Nsun2 T C 13: 69,691,992 (GRCm39) probably benign Het
Oas2 T A 5: 120,876,599 (GRCm39) D448V probably damaging Het
Or10al7 C A 17: 38,366,467 (GRCm39) V6F probably benign Het
Or2l13b A T 16: 19,349,383 (GRCm39) C96S probably damaging Het
Or5ak22 T C 2: 85,230,772 (GRCm39) Y35C probably damaging Het
Pgm2l1 T A 7: 99,877,204 (GRCm39) L25Q probably damaging Het
Pigp A T 16: 94,166,309 (GRCm39) V133D probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Pomt2 C T 12: 87,156,881 (GRCm39) D752N possibly damaging Het
Ppat T C 5: 77,074,640 (GRCm39) K65E probably damaging Het
Ptprn2 T C 12: 117,125,314 (GRCm39) L616P probably damaging Het
Rad54l2 A G 9: 106,595,091 (GRCm39) S289P probably damaging Het
Rbm39 G A 2: 156,019,266 (GRCm39) R31C possibly damaging Het
Rhbdf2 C A 11: 116,492,771 (GRCm39) V417L probably benign Het
Rnf157 T A 11: 116,246,298 (GRCm39) E255D possibly damaging Het
Rpl6l A T 10: 110,962,304 (GRCm39) noncoding transcript Het
Sec24c A G 14: 20,743,813 (GRCm39) D1006G probably damaging Het
Sh3bp1 G T 15: 78,792,237 (GRCm39) A401S probably benign Het
Slc17a8 A T 10: 89,412,367 (GRCm39) D539E probably benign Het
Slc38a9 T A 13: 112,826,098 (GRCm39) S136R probably damaging Het
Smoc2 A C 17: 14,589,295 (GRCm39) T255P probably benign Het
Smyd2 T C 1: 189,628,847 (GRCm39) D152G probably damaging Het
Stab1 A G 14: 30,862,350 (GRCm39) V2328A probably damaging Het
Taar2 A G 10: 23,816,591 (GRCm39) I44V probably benign Het
Tbc1d4 T C 14: 101,682,144 (GRCm39) K1251E probably benign Het
Thada G A 17: 84,754,027 (GRCm39) L315F probably damaging Het
Trbv14 T C 6: 41,112,259 (GRCm39) S19P probably benign Het
Ttc39c T C 18: 12,820,173 (GRCm39) probably benign Het
Ttc39d A G 17: 80,524,527 (GRCm39) I395M probably benign Het
Ttn T C 2: 76,548,728 (GRCm39) E31891G probably damaging Het
Ubr3 T C 2: 69,800,527 (GRCm39) V950A probably damaging Het
Usp9y T A Y: 1,307,920 (GRCm39) K2305N probably damaging Het
Vmn1r158 G A 7: 22,490,179 (GRCm39) T10I possibly damaging Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Vmn2r86 G T 10: 130,289,460 (GRCm39) T145K probably damaging Het
Zfp51 T C 17: 21,684,933 (GRCm39) V516A probably benign Het
Zfp654 A T 16: 64,606,145 (GRCm39) S686T probably benign Het
Zfp846 T A 9: 20,502,111 (GRCm39) C55S probably benign Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86,564,569 (GRCm39) missense unknown
IGL01473:Vmn2r78 APN 7 86,569,520 (GRCm39) missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86,603,643 (GRCm39) missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86,570,687 (GRCm39) missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86,603,496 (GRCm39) missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86,569,969 (GRCm39) nonsense probably null
ANU74:Vmn2r78 UTSW 7 86,570,273 (GRCm39) missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86,569,413 (GRCm39) missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86,572,235 (GRCm39) missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86,570,519 (GRCm39) missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86,603,588 (GRCm39) missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86,571,477 (GRCm39) missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86,564,615 (GRCm39) missense unknown
R1526:Vmn2r78 UTSW 7 86,571,465 (GRCm39) splice site probably null
R1712:Vmn2r78 UTSW 7 86,604,132 (GRCm39) missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86,569,997 (GRCm39) missense probably benign
R1812:Vmn2r78 UTSW 7 86,569,995 (GRCm39) missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86,604,287 (GRCm39) missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86,603,690 (GRCm39) missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86,570,535 (GRCm39) missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86,569,362 (GRCm39) missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86,569,953 (GRCm39) splice site probably benign
R3023:Vmn2r78 UTSW 7 86,604,174 (GRCm39) missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86,569,959 (GRCm39) critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86,569,452 (GRCm39) missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86,570,399 (GRCm39) missense probably benign
R4546:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R4928:Vmn2r78 UTSW 7 86,603,835 (GRCm39) missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86,571,563 (GRCm39) missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86,569,332 (GRCm39) missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86,570,238 (GRCm39) missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86,569,330 (GRCm39) missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86,570,737 (GRCm39) missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86,564,720 (GRCm39) missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86,603,637 (GRCm39) missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86,603,796 (GRCm39) missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86,604,115 (GRCm39) missense probably benign 0.00
R5977:Vmn2r78 UTSW 7 86,569,541 (GRCm39) missense possibly damaging 0.74
R6276:Vmn2r78 UTSW 7 86,570,318 (GRCm39) missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86,571,545 (GRCm39) nonsense probably null
R6724:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86,571,558 (GRCm39) missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86,571,633 (GRCm39) missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86,603,552 (GRCm39) nonsense probably null
R7680:Vmn2r78 UTSW 7 86,604,149 (GRCm39) missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86,570,343 (GRCm39) missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86,569,378 (GRCm39) nonsense probably null
R8031:Vmn2r78 UTSW 7 86,604,075 (GRCm39) missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86,571,695 (GRCm39) missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86,603,998 (GRCm39) missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86,603,660 (GRCm39) missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86,570,094 (GRCm39) missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86,603,513 (GRCm39) missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86,569,431 (GRCm39) missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86,603,639 (GRCm39) nonsense probably null
Z1177:Vmn2r78 UTSW 7 86,603,982 (GRCm39) missense probably benign 0.02
Z1177:Vmn2r78 UTSW 7 86,570,415 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATCCCACTATGGTTAGCTGCATC -3'
(R):5'- GCTTCATTGAACGTGTCAGG -3'

Sequencing Primer
(F):5'- TCCTGCAACAGACCACATTTG -3'
(R):5'- CATTGAACGTGTCAGGGAGATTCC -3'
Posted On 2016-03-17