Incidental Mutation 'R0295:Zfp292'
ID 37666
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Name zinc finger protein 292
Synonyms Zfp-15, 9430062L07Rik, Zn-16, Zfp15, Zn-15, 5730450D02Rik, Krox-10
MMRRC Submission 038512-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.861) question?
Stock # R0295 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 34803113-34882960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34806281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 2254 (N2254K)
Ref Sequence ENSEMBL: ENSMUSP00000095766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
AlphaFold Q9Z2U2
Predicted Effect probably damaging
Transcript: ENSMUST00000047950
AA Change: N2259K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: N2259K

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098163
AA Change: N2254K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: N2254K

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Meta Mutation Damage Score 0.1327 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,290,642 (GRCm39) S127N probably damaging Het
Abcc8 T C 7: 45,767,478 (GRCm39) R953G probably benign Het
Adamtsl3 T A 7: 82,197,213 (GRCm39) probably null Het
Adh4 A G 3: 138,134,837 (GRCm39) D337G probably damaging Het
Apob T A 12: 8,052,181 (GRCm39) Y1207* probably null Het
Birc6 T C 17: 74,920,357 (GRCm39) probably benign Het
Bms1 A G 6: 118,366,298 (GRCm39) I1065T probably benign Het
Cacna1i T A 15: 80,240,412 (GRCm39) L378Q probably damaging Het
Ccdc127 C A 13: 74,504,989 (GRCm39) P179H probably damaging Het
Ccdc18 A T 5: 108,321,655 (GRCm39) K586N probably damaging Het
Cep290 A C 10: 100,373,683 (GRCm39) E1321A probably damaging Het
Cstpp1 A T 2: 91,112,939 (GRCm39) I173N probably damaging Het
Ctc1 A G 11: 68,921,414 (GRCm39) K682E possibly damaging Het
Cux1 A C 5: 136,342,066 (GRCm39) V442G probably benign Het
Dph2 A T 4: 117,748,127 (GRCm39) V150E possibly damaging Het
Etv6 A G 6: 134,243,238 (GRCm39) D331G probably benign Het
Fbxo42 A G 4: 140,927,808 (GRCm39) D696G probably damaging Het
Fbxo8 G A 8: 57,043,109 (GRCm39) D198N probably benign Het
Gria4 T C 9: 4,793,840 (GRCm39) T73A possibly damaging Het
H2aj C G 6: 136,785,602 (GRCm39) R89G probably damaging Het
Ifng G T 10: 118,277,154 (GRCm39) S32I possibly damaging Het
Ildr1 A G 16: 36,529,839 (GRCm39) probably null Het
Knl1 A C 2: 118,919,320 (GRCm39) D1824A probably damaging Het
Lamp3 A T 16: 19,519,858 (GRCm39) Y108* probably null Het
Lcp1 A G 14: 75,436,860 (GRCm39) I69V probably null Het
Lrp6 A T 6: 134,434,656 (GRCm39) V1349E probably benign Het
Lrrcc1 A T 3: 14,630,909 (GRCm39) E1009D probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Med14 G C X: 12,551,987 (GRCm39) R1223G probably damaging Het
Mesd C T 7: 83,547,073 (GRCm39) Q179* probably null Het
Myh7 A G 14: 55,222,278 (GRCm39) probably benign Het
Myo6 T C 9: 80,190,861 (GRCm39) I804T probably damaging Het
Neb T C 2: 52,174,297 (GRCm39) I1521V possibly damaging Het
Nosip T A 7: 44,726,340 (GRCm39) I249N probably damaging Het
Nostrin A C 2: 69,009,760 (GRCm39) E296A probably benign Het
Oprk1 T C 1: 5,669,073 (GRCm39) L173S possibly damaging Het
Or2n1d A T 17: 38,646,182 (GRCm39) I45F probably damaging Het
Or4k36 T A 2: 111,146,499 (GRCm39) V225D probably damaging Het
Or51v8 T C 7: 103,319,518 (GRCm39) H240R probably damaging Het
Or5p1 T G 7: 107,916,892 (GRCm39) S264A probably benign Het
Pdzd7 A G 19: 45,025,511 (GRCm39) V328A probably benign Het
Podxl2 A T 6: 88,826,660 (GRCm39) S215R probably benign Het
Prss36 T G 7: 127,535,027 (GRCm39) T418P possibly damaging Het
Ralgps2 T A 1: 156,651,555 (GRCm39) probably benign Het
Rasa2 T C 9: 96,427,863 (GRCm39) probably null Het
Rgs1 A T 1: 144,121,224 (GRCm39) I149N probably damaging Het
Rgs16 A G 1: 153,619,483 (GRCm39) E163G probably damaging Het
Rnf121 A G 7: 101,684,553 (GRCm39) F120S possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slfn8 A T 11: 82,894,169 (GRCm39) Y823* probably null Het
Spdl1 A T 11: 34,704,170 (GRCm39) N554K possibly damaging Het
St6gal1 T A 16: 23,174,953 (GRCm39) probably benign Het
Tet3 G A 6: 83,346,121 (GRCm39) P1304S probably benign Het
Timm29 T C 9: 21,504,372 (GRCm39) probably null Het
Tpcn1 T A 5: 120,677,125 (GRCm39) I687F probably damaging Het
Trim46 A G 3: 89,152,420 (GRCm39) probably benign Het
Ttc23 T A 7: 67,319,600 (GRCm39) probably benign Het
Ttll6 G T 11: 96,045,540 (GRCm39) V586L probably benign Het
Ttn A T 2: 76,588,955 (GRCm39) probably benign Het
Uba3 A T 6: 97,168,544 (GRCm39) H160Q possibly damaging Het
Usp32 A G 11: 84,944,518 (GRCm39) S316P probably damaging Het
Vcan T C 13: 89,860,310 (GRCm39) I352M probably benign Het
Zcwpw1 G T 5: 137,815,734 (GRCm39) L412F probably damaging Het
Zscan4e A G 7: 11,041,543 (GRCm39) S138P probably damaging Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34,808,683 (GRCm39) missense probably benign 0.15
IGL00502:Zfp292 APN 4 34,809,775 (GRCm39) missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34,808,790 (GRCm39) missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34,807,827 (GRCm39) missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34,806,763 (GRCm39) missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34,807,961 (GRCm39) missense probably benign 0.01
IGL01639:Zfp292 APN 4 34,809,048 (GRCm39) missense probably benign 0.04
IGL01688:Zfp292 APN 4 34,807,855 (GRCm39) missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34,809,244 (GRCm39) missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34,808,810 (GRCm39) missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34,805,416 (GRCm39) missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34,806,462 (GRCm39) missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34,809,415 (GRCm39) missense probably benign 0.14
IGL02715:Zfp292 APN 4 34,819,542 (GRCm39) missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34,806,163 (GRCm39) missense probably benign 0.00
F5770:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34,807,524 (GRCm39) missense probably benign 0.00
R0153:Zfp292 UTSW 4 34,811,185 (GRCm39) missense probably benign 0.26
R0184:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34,808,227 (GRCm39) missense probably benign 0.25
R0433:Zfp292 UTSW 4 34,839,959 (GRCm39) missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34,810,059 (GRCm39) missense probably benign 0.28
R0555:Zfp292 UTSW 4 34,807,194 (GRCm39) missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34,807,399 (GRCm39) missense probably benign 0.02
R0748:Zfp292 UTSW 4 34,816,424 (GRCm39) splice site probably benign
R0782:Zfp292 UTSW 4 34,839,382 (GRCm39) missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34,809,114 (GRCm39) missense probably benign 0.00
R0879:Zfp292 UTSW 4 34,811,218 (GRCm39) missense probably benign 0.00
R1083:Zfp292 UTSW 4 34,807,569 (GRCm39) missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34,805,238 (GRCm39) missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34,805,397 (GRCm39) missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34,808,935 (GRCm39) missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34,811,237 (GRCm39) missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34,811,043 (GRCm39) missense probably benign 0.02
R1837:Zfp292 UTSW 4 34,810,264 (GRCm39) missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34,807,452 (GRCm39) missense probably benign 0.22
R2107:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34,810,266 (GRCm39) missense probably benign 0.13
R2182:Zfp292 UTSW 4 34,807,417 (GRCm39) missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34,807,962 (GRCm39) missense probably benign 0.07
R2306:Zfp292 UTSW 4 34,809,468 (GRCm39) missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34,811,281 (GRCm39) missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34,806,426 (GRCm39) missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34,808,814 (GRCm39) missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34,810,326 (GRCm39) missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34,807,744 (GRCm39) missense probably benign 0.00
R4006:Zfp292 UTSW 4 34,809,611 (GRCm39) missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34,806,079 (GRCm39) missense probably benign 0.04
R4641:Zfp292 UTSW 4 34,807,828 (GRCm39) missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34,807,078 (GRCm39) missense probably benign 0.00
R4718:Zfp292 UTSW 4 34,819,521 (GRCm39) missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34,808,917 (GRCm39) missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34,839,878 (GRCm39) missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34,809,755 (GRCm39) missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34,805,842 (GRCm39) missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34,807,491 (GRCm39) missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34,806,261 (GRCm39) missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34,811,703 (GRCm39) missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34,806,747 (GRCm39) missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34,805,125 (GRCm39) missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34,805,464 (GRCm39) missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34,811,902 (GRCm39) missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34,808,497 (GRCm39) missense probably benign 0.13
R6209:Zfp292 UTSW 4 34,809,442 (GRCm39) missense probably benign 0.14
R6275:Zfp292 UTSW 4 34,808,883 (GRCm39) missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34,816,301 (GRCm39) missense probably benign 0.21
R6747:Zfp292 UTSW 4 34,806,894 (GRCm39) missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34,807,812 (GRCm39) missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34,816,357 (GRCm39) missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34,806,796 (GRCm39) missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34,808,679 (GRCm39) missense probably benign
R7254:Zfp292 UTSW 4 34,819,476 (GRCm39) missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34,806,839 (GRCm39) missense probably benign
R7378:Zfp292 UTSW 4 34,808,384 (GRCm39) missense probably benign 0.26
R7535:Zfp292 UTSW 4 34,811,487 (GRCm39) missense probably benign 0.28
R7589:Zfp292 UTSW 4 34,806,777 (GRCm39) missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34,809,865 (GRCm39) missense probably benign 0.02
R7979:Zfp292 UTSW 4 34,809,198 (GRCm39) missense probably benign 0.02
R7997:Zfp292 UTSW 4 34,808,688 (GRCm39) missense probably damaging 0.96
R8129:Zfp292 UTSW 4 34,807,386 (GRCm39) missense probably damaging 1.00
R8211:Zfp292 UTSW 4 34,806,163 (GRCm39) missense probably benign 0.00
R8302:Zfp292 UTSW 4 34,810,893 (GRCm39) missense possibly damaging 0.64
R8500:Zfp292 UTSW 4 34,826,691 (GRCm39) critical splice donor site probably null
R8709:Zfp292 UTSW 4 34,805,982 (GRCm39) missense probably damaging 1.00
R8947:Zfp292 UTSW 4 34,811,835 (GRCm39) missense probably damaging 1.00
R9099:Zfp292 UTSW 4 34,809,228 (GRCm39) missense possibly damaging 0.53
R9190:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R9256:Zfp292 UTSW 4 34,839,899 (GRCm39) missense probably benign 0.02
R9371:Zfp292 UTSW 4 34,810,800 (GRCm39) missense probably damaging 1.00
R9492:Zfp292 UTSW 4 34,810,794 (GRCm39) missense probably benign 0.12
R9574:Zfp292 UTSW 4 34,839,460 (GRCm39) missense probably damaging 1.00
V7580:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
Z1177:Zfp292 UTSW 4 34,811,058 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACACTCTGCCAAGGCATCATTC -3'
(R):5'- AATTGAAAGCATGACTGCTGCTGTG -3'

Sequencing Primer
(F):5'- AAGGCATCATTCCTAGCCTTTATGG -3'
(R):5'- GTTGGCAAATTTCCATGTGATCAG -3'
Posted On 2013-05-23