Mutagenetix > Incidental Mutation

Incidental Mutation 'R4872:Rad54l2'

376666

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

MMRRC Submission

042482-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4872 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106717892 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 289 (S289P)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046502
AA Change: S289P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: S289P

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190363

Meta Mutation Damage Score

0.6954

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

98% (81/83)

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	C	A	15: 91,191,311	V100L	probably benign	Het
Acad11	G	A	9: 104,086,266		probably benign	Het
Actb	C	T	5: 142,905,552		probably benign	Het
Ano9	G	A	7: 141,107,204	A374V	probably damaging	Het
Baz2b	T	C	2: 59,942,759		probably null	Het
Bpifb9b	T	A	2: 154,313,631	L350Q	probably damaging	Het
Cd27	T	A	6: 125,234,318		probably null	Het
Cd72	A	G	4: 43,449,563		probably benign	Het
Cdadc1	A	T	14: 59,564,524	S516T	probably benign	Het
Chst5	T	A	8: 111,890,560	I143F	possibly damaging	Het
Col20a1	T	C	2: 180,997,363	V452A	possibly damaging	Het
Cox11	C	A	11: 90,644,403	Q227K	probably benign	Het
Cpa6	A	G	1: 10,595,618		probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dpm2	T	C	2: 32,571,191		probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Frem1	A	C	4: 82,963,150	N1273K	probably damaging	Het
Fry	T	C	5: 150,394,239		probably null	Het
Gm10306	G	T	4: 94,556,832		probably benign	Het
Gm5565	T	C	5: 146,158,103	T278A	probably benign	Het
Gm8180	A	G	14: 43,782,345	I40T	probably benign	Het
Iah1	T	C	12: 21,317,425	V44A	probably benign	Het
Iqgap3	C	T	3: 88,113,128	P360S	probably damaging	Het
Klhl28	T	A	12: 64,957,122	I206F	possibly damaging	Het
Krt13	A	G	11: 100,121,506		probably benign	Het
Lipo2	T	A	19: 33,749,514	D41V	probably benign	Het
Lrig2	C	G	3: 104,491,526	V229L	possibly damaging	Het
Lrrc32	C	T	7: 98,498,520	T169I	probably damaging	Het
Lrriq1	T	C	10: 103,178,788	N1053S	possibly damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mgat4c	G	C	10: 102,388,738	R271P	probably damaging	Het
Mylk	A	G	16: 34,914,990	N780S	possibly damaging	Het
N4bp1	T	C	8: 86,861,048	T421A	probably benign	Het
Nat8f1	T	C	6: 85,910,313	T222A	probably benign	Het
Nsun2	T	C	13: 69,543,873		probably benign	Het
Oas2	T	A	5: 120,738,534	D448V	probably damaging	Het
Olfr129	C	A	17: 38,055,576	V6F	probably benign	Het
Olfr168	A	T	16: 19,530,633	C96S	probably damaging	Het
Olfr992	T	C	2: 85,400,428	Y35C	probably damaging	Het
Pgm2l1	T	A	7: 100,227,997	L25Q	probably damaging	Het
Pigp	A	T	16: 94,365,450	V133D	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Pomt2	C	T	12: 87,110,107	D752N	possibly damaging	Het
Ppat	T	C	5: 76,926,793	K65E	probably damaging	Het
Ptprn2	T	C	12: 117,161,694	L616P	probably damaging	Het
Rbm39	G	A	2: 156,177,346	R31C	possibly damaging	Het
Rhbdf2	C	A	11: 116,601,945	V417L	probably benign	Het
Rnf157	T	A	11: 116,355,472	E255D	possibly damaging	Het
Rpl6l	A	T	10: 111,126,443		noncoding transcript	Het
Sec24c	A	G	14: 20,693,745	D1006G	probably damaging	Het
Sh3bp1	G	T	15: 78,908,037	A401S	probably benign	Het
Slc17a8	A	T	10: 89,576,505	D539E	probably benign	Het
Slc38a9	T	A	13: 112,689,564	S136R	probably damaging	Het
Smoc2	A	C	17: 14,369,033	T255P	probably benign	Het
Smyd2	T	C	1: 189,896,650	D152G	probably damaging	Het
Stab1	A	G	14: 31,140,393	V2328A	probably damaging	Het
Taar2	A	G	10: 23,940,693	I44V	probably benign	Het
Tbc1d4	T	C	14: 101,444,708	K1251E	probably benign	Het
Thada	G	A	17: 84,446,599	L315F	probably damaging	Het
Trbv14	T	C	6: 41,135,325	S19P	probably benign	Het
Ttc39c	T	C	18: 12,687,116		probably benign	Het
Ttc39d	A	G	17: 80,217,098	I395M	probably benign	Het
Ttn	T	C	2: 76,718,384	E31891G	probably damaging	Het
Ubr3	T	C	2: 69,970,183	V950A	probably damaging	Het
Uhrf1bp1	G	T	17: 27,890,136	D1110Y	probably benign	Het
Usp9y	T	A	Y: 1,307,920	K2305N	probably damaging	Het
Vmn1r158	G	A	7: 22,790,754	T10I	possibly damaging	Het
Vmn2r78	T	A	7: 86,954,708	I698K	possibly damaging	Het
Vmn2r86	G	T	10: 130,453,591	T145K	probably damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Zfp51	T	C	17: 21,464,671	V516A	probably benign	Het
Zfp654	A	T	16: 64,785,782	S686T	probably benign	Het
Zfp846	T	A	9: 20,590,815	C55S	probably benign	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCAGAGATGTTCAAAGGG -3'
(R):5'- ACTAGCCAGAGTGACAAAATTCTG -3'

Sequencing Primer
(F):5'- AGGGTGAGTTAAGAGCTCTTACC -3'
(R):5'- ATTCTGTAGACCAGTCAGGGTATAG -3'

Posted On

2016-03-17