Incidental Mutation 'R4872:Slc38a9'
ID376684
Institutional Source Beutler Lab
Gene Symbol Slc38a9
Ensembl Gene ENSMUSG00000047789
Gene Namesolute carrier family 38, member 9
Synonyms
MMRRC Submission 042482-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R4872 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112660751-112738749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112689564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 136 (S136R)
Ref Sequence ENSEMBL: ENSMUSP00000052172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052514] [ENSMUST00000223581]
Predicted Effect probably damaging
Transcript: ENSMUST00000052514
AA Change: S136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052172
Gene: ENSMUSG00000047789
AA Change: S136R

DomainStartEndE-ValueType
Pfam:Aa_trans 114 253 4.5e-17 PFAM
Pfam:Aa_trans 266 560 2.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224584
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 C A 15: 91,191,311 V100L probably benign Het
Acad11 G A 9: 104,086,266 probably benign Het
Actb C T 5: 142,905,552 probably benign Het
Ano9 G A 7: 141,107,204 A374V probably damaging Het
Baz2b T C 2: 59,942,759 probably null Het
Bpifb9b T A 2: 154,313,631 L350Q probably damaging Het
Cd27 T A 6: 125,234,318 probably null Het
Cd72 A G 4: 43,449,563 probably benign Het
Cdadc1 A T 14: 59,564,524 S516T probably benign Het
Chst5 T A 8: 111,890,560 I143F possibly damaging Het
Col20a1 T C 2: 180,997,363 V452A possibly damaging Het
Cox11 C A 11: 90,644,403 Q227K probably benign Het
Cpa6 A G 1: 10,595,618 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpm2 T C 2: 32,571,191 probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Frem1 A C 4: 82,963,150 N1273K probably damaging Het
Fry T C 5: 150,394,239 probably null Het
Gm10306 G T 4: 94,556,832 probably benign Het
Gm5565 T C 5: 146,158,103 T278A probably benign Het
Gm8180 A G 14: 43,782,345 I40T probably benign Het
Iah1 T C 12: 21,317,425 V44A probably benign Het
Iqgap3 C T 3: 88,113,128 P360S probably damaging Het
Klhl28 T A 12: 64,957,122 I206F possibly damaging Het
Krt13 A G 11: 100,121,506 probably benign Het
Lipo2 T A 19: 33,749,514 D41V probably benign Het
Lrig2 C G 3: 104,491,526 V229L possibly damaging Het
Lrrc32 C T 7: 98,498,520 T169I probably damaging Het
Lrriq1 T C 10: 103,178,788 N1053S possibly damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mgat4c G C 10: 102,388,738 R271P probably damaging Het
Mylk A G 16: 34,914,990 N780S possibly damaging Het
N4bp1 T C 8: 86,861,048 T421A probably benign Het
Nat8f1 T C 6: 85,910,313 T222A probably benign Het
Nsun2 T C 13: 69,543,873 probably benign Het
Oas2 T A 5: 120,738,534 D448V probably damaging Het
Olfr129 C A 17: 38,055,576 V6F probably benign Het
Olfr168 A T 16: 19,530,633 C96S probably damaging Het
Olfr992 T C 2: 85,400,428 Y35C probably damaging Het
Pgm2l1 T A 7: 100,227,997 L25Q probably damaging Het
Pigp A T 16: 94,365,450 V133D probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pomt2 C T 12: 87,110,107 D752N possibly damaging Het
Ppat T C 5: 76,926,793 K65E probably damaging Het
Ptprn2 T C 12: 117,161,694 L616P probably damaging Het
Rad54l2 A G 9: 106,717,892 S289P probably damaging Het
Rbm39 G A 2: 156,177,346 R31C possibly damaging Het
Rhbdf2 C A 11: 116,601,945 V417L probably benign Het
Rnf157 T A 11: 116,355,472 E255D possibly damaging Het
Rpl6l A T 10: 111,126,443 noncoding transcript Het
Sec24c A G 14: 20,693,745 D1006G probably damaging Het
Sh3bp1 G T 15: 78,908,037 A401S probably benign Het
Slc17a8 A T 10: 89,576,505 D539E probably benign Het
Smoc2 A C 17: 14,369,033 T255P probably benign Het
Smyd2 T C 1: 189,896,650 D152G probably damaging Het
Stab1 A G 14: 31,140,393 V2328A probably damaging Het
Taar2 A G 10: 23,940,693 I44V probably benign Het
Tbc1d4 T C 14: 101,444,708 K1251E probably benign Het
Thada G A 17: 84,446,599 L315F probably damaging Het
Trbv14 T C 6: 41,135,325 S19P probably benign Het
Ttc39c T C 18: 12,687,116 probably benign Het
Ttc39d A G 17: 80,217,098 I395M probably benign Het
Ttn T C 2: 76,718,384 E31891G probably damaging Het
Ubr3 T C 2: 69,970,183 V950A probably damaging Het
Uhrf1bp1 G T 17: 27,890,136 D1110Y probably benign Het
Usp9y T A Y: 1,307,920 K2305N probably damaging Het
Vmn1r158 G A 7: 22,790,754 T10I possibly damaging Het
Vmn2r78 T A 7: 86,954,708 I698K possibly damaging Het
Vmn2r86 G T 10: 130,453,591 T145K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp51 T C 17: 21,464,671 V516A probably benign Het
Zfp654 A T 16: 64,785,782 S686T probably benign Het
Zfp846 T A 9: 20,590,815 C55S probably benign Het
Other mutations in Slc38a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Slc38a9 APN 13 112701618 missense probably damaging 1.00
IGL01950:Slc38a9 APN 13 112695253 missense probably damaging 1.00
IGL01955:Slc38a9 APN 13 112695418 splice site probably benign
IGL02352:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02359:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02407:Slc38a9 APN 13 112690243 missense probably benign
IGL02511:Slc38a9 APN 13 112698007 missense possibly damaging 0.47
IGL02588:Slc38a9 APN 13 112697977 splice site probably null
IGL03278:Slc38a9 APN 13 112689518 splice site probably benign
R0126:Slc38a9 UTSW 13 112729257 missense possibly damaging 0.52
R0553:Slc38a9 UTSW 13 112714198 missense probably damaging 1.00
R0558:Slc38a9 UTSW 13 112729196 critical splice acceptor site probably null
R0699:Slc38a9 UTSW 13 112723289 missense probably damaging 1.00
R1036:Slc38a9 UTSW 13 112701659 splice site probably benign
R1142:Slc38a9 UTSW 13 112714210 missense probably damaging 1.00
R1344:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R1418:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R4223:Slc38a9 UTSW 13 112714248 critical splice donor site probably null
R4344:Slc38a9 UTSW 13 112729215 missense probably benign 0.02
R4824:Slc38a9 UTSW 13 112723298 missense probably damaging 0.98
R5841:Slc38a9 UTSW 13 112695322 missense possibly damaging 0.76
R5844:Slc38a9 UTSW 13 112731501 missense probably damaging 1.00
R6039:Slc38a9 UTSW 13 112669697 missense probably damaging 1.00
R6039:Slc38a9 UTSW 13 112669697 missense probably damaging 1.00
R6151:Slc38a9 UTSW 13 112689376 missense probably damaging 1.00
R6166:Slc38a9 UTSW 13 112695267 missense possibly damaging 0.96
R6175:Slc38a9 UTSW 13 112703559 nonsense probably null
R6324:Slc38a9 UTSW 13 112726100 missense probably benign 0.01
R6747:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R6920:Slc38a9 UTSW 13 112701526 missense possibly damaging 0.63
R7342:Slc38a9 UTSW 13 112669591 start gained probably benign
R7592:Slc38a9 UTSW 13 112695355 missense probably damaging 0.99
R7787:Slc38a9 UTSW 13 112689346 missense probably damaging 0.99
R7860:Slc38a9 UTSW 13 112731614 missense probably benign
R7943:Slc38a9 UTSW 13 112731614 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTATGTGAGTAAACTACCTCTTGGAGC -3'
(R):5'- AGTGATCATTTTCTTTTCCAGTGCG -3'

Sequencing Primer
(F):5'- CCTCTTGGAGCATGAATTAAACTGCG -3'
(R):5'- TGTAGCCCAAACTGGTCTTGAAC -3'
Posted On2016-03-17