Incidental Mutation 'R4872:Mfng'
ID 376689
Institutional Source Beutler Lab
Gene Symbol Mfng
Ensembl Gene ENSMUSG00000018169
Gene Name MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonyms manic fringe
MMRRC Submission 042482-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R4872 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 78640082-78657675 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78648588 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 163 (R163H)
Ref Sequence ENSEMBL: ENSMUSP00000018313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018313]
AlphaFold O09008
PDB Structure STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE [X-RAY DIFFRACTION]
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE IN COMPLEX WITH UDP AND MANGANESE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000018313
AA Change: R163H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018313
Gene: ENSMUSG00000018169
AA Change: R163H

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Fringe 49 300 6.9e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136795
Meta Mutation Damage Score 0.1111 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and lunatic fringe genes. They all encode evolutionarily conserved secreted proteins that act in the Notch receptor pathway to demarcate boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit normal pancreatic development, morphology and physiology. Mice homozygous for a different knock-out allele exhibit altered lymphocyte numbers, abnormal circulating factors II, VII, IX and XI, and decreased prothrombin and partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 C A 15: 91,075,514 (GRCm39) V100L probably benign Het
Acad11 G A 9: 103,963,465 (GRCm39) probably benign Het
Actb C T 5: 142,891,307 (GRCm39) probably benign Het
Ano9 G A 7: 140,687,117 (GRCm39) A374V probably damaging Het
Baz2b T C 2: 59,773,103 (GRCm39) probably null Het
Bltp3a G T 17: 28,109,110 (GRCm39) D1110Y probably benign Het
Bpifb9b T A 2: 154,155,551 (GRCm39) L350Q probably damaging Het
Cd27 T A 6: 125,211,281 (GRCm39) probably null Het
Cd72 A G 4: 43,449,563 (GRCm39) probably benign Het
Cdadc1 A T 14: 59,801,973 (GRCm39) S516T probably benign Het
Chst5 T A 8: 112,617,192 (GRCm39) I143F possibly damaging Het
Col20a1 T C 2: 180,639,156 (GRCm39) V452A possibly damaging Het
Cox11 C A 11: 90,535,229 (GRCm39) Q227K probably benign Het
Cpa6 A G 1: 10,665,843 (GRCm39) probably null Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dpm2 T C 2: 32,461,203 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Frem1 A C 4: 82,881,387 (GRCm39) N1273K probably damaging Het
Fry T C 5: 150,317,704 (GRCm39) probably null Het
Gm10306 G T 4: 94,445,069 (GRCm39) probably benign Het
Gm5565 T C 5: 146,094,913 (GRCm39) T278A probably benign Het
Gm8180 A G 14: 44,019,802 (GRCm39) I40T probably benign Het
Iah1 T C 12: 21,367,426 (GRCm39) V44A probably benign Het
Iqgap3 C T 3: 88,020,435 (GRCm39) P360S probably damaging Het
Klhl28 T A 12: 65,003,896 (GRCm39) I206F possibly damaging Het
Krt13 A G 11: 100,012,332 (GRCm39) probably benign Het
Lipo2 T A 19: 33,726,914 (GRCm39) D41V probably benign Het
Lrig2 C G 3: 104,398,842 (GRCm39) V229L possibly damaging Het
Lrrc32 C T 7: 98,147,727 (GRCm39) T169I probably damaging Het
Lrriq1 T C 10: 103,014,649 (GRCm39) N1053S possibly damaging Het
Mgat4c G C 10: 102,224,599 (GRCm39) R271P probably damaging Het
Mylk A G 16: 34,735,360 (GRCm39) N780S possibly damaging Het
N4bp1 T C 8: 87,587,676 (GRCm39) T421A probably benign Het
Nat8f1 T C 6: 85,887,295 (GRCm39) T222A probably benign Het
Nsun2 T C 13: 69,691,992 (GRCm39) probably benign Het
Oas2 T A 5: 120,876,599 (GRCm39) D448V probably damaging Het
Or10al7 C A 17: 38,366,467 (GRCm39) V6F probably benign Het
Or2l13b A T 16: 19,349,383 (GRCm39) C96S probably damaging Het
Or5ak22 T C 2: 85,230,772 (GRCm39) Y35C probably damaging Het
Pgm2l1 T A 7: 99,877,204 (GRCm39) L25Q probably damaging Het
Pigp A T 16: 94,166,309 (GRCm39) V133D probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Pomt2 C T 12: 87,156,881 (GRCm39) D752N possibly damaging Het
Ppat T C 5: 77,074,640 (GRCm39) K65E probably damaging Het
Ptprn2 T C 12: 117,125,314 (GRCm39) L616P probably damaging Het
Rad54l2 A G 9: 106,595,091 (GRCm39) S289P probably damaging Het
Rbm39 G A 2: 156,019,266 (GRCm39) R31C possibly damaging Het
Rhbdf2 C A 11: 116,492,771 (GRCm39) V417L probably benign Het
Rnf157 T A 11: 116,246,298 (GRCm39) E255D possibly damaging Het
Rpl6l A T 10: 110,962,304 (GRCm39) noncoding transcript Het
Sec24c A G 14: 20,743,813 (GRCm39) D1006G probably damaging Het
Sh3bp1 G T 15: 78,792,237 (GRCm39) A401S probably benign Het
Slc17a8 A T 10: 89,412,367 (GRCm39) D539E probably benign Het
Slc38a9 T A 13: 112,826,098 (GRCm39) S136R probably damaging Het
Smoc2 A C 17: 14,589,295 (GRCm39) T255P probably benign Het
Smyd2 T C 1: 189,628,847 (GRCm39) D152G probably damaging Het
Stab1 A G 14: 30,862,350 (GRCm39) V2328A probably damaging Het
Taar2 A G 10: 23,816,591 (GRCm39) I44V probably benign Het
Tbc1d4 T C 14: 101,682,144 (GRCm39) K1251E probably benign Het
Thada G A 17: 84,754,027 (GRCm39) L315F probably damaging Het
Trbv14 T C 6: 41,112,259 (GRCm39) S19P probably benign Het
Ttc39c T C 18: 12,820,173 (GRCm39) probably benign Het
Ttc39d A G 17: 80,524,527 (GRCm39) I395M probably benign Het
Ttn T C 2: 76,548,728 (GRCm39) E31891G probably damaging Het
Ubr3 T C 2: 69,800,527 (GRCm39) V950A probably damaging Het
Usp9y T A Y: 1,307,920 (GRCm39) K2305N probably damaging Het
Vmn1r158 G A 7: 22,490,179 (GRCm39) T10I possibly damaging Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Vmn2r78 T A 7: 86,603,916 (GRCm39) I698K possibly damaging Het
Vmn2r86 G T 10: 130,289,460 (GRCm39) T145K probably damaging Het
Zfp51 T C 17: 21,684,933 (GRCm39) V516A probably benign Het
Zfp654 A T 16: 64,606,145 (GRCm39) S686T probably benign Het
Zfp846 T A 9: 20,502,111 (GRCm39) C55S probably benign Het
Other mutations in Mfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mfng UTSW 15 78,648,637 (GRCm39) missense possibly damaging 0.79
R0504:Mfng UTSW 15 78,641,514 (GRCm39) missense probably benign 0.00
R1905:Mfng UTSW 15 78,657,286 (GRCm39) missense probably damaging 1.00
R3871:Mfng UTSW 15 78,640,821 (GRCm39) missense probably damaging 1.00
R4845:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R4874:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R4925:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R4934:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5006:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5029:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5048:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5064:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5067:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5143:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5145:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5146:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5266:Mfng UTSW 15 78,648,588 (GRCm39) missense probably benign
R5969:Mfng UTSW 15 78,648,582 (GRCm39) missense possibly damaging 0.94
R6012:Mfng UTSW 15 78,640,840 (GRCm39) missense probably damaging 1.00
R6654:Mfng UTSW 15 78,643,539 (GRCm39) missense probably damaging 1.00
R7211:Mfng UTSW 15 78,657,268 (GRCm39) missense probably benign 0.12
R7793:Mfng UTSW 15 78,657,265 (GRCm39) missense probably damaging 1.00
R8292:Mfng UTSW 15 78,657,370 (GRCm39) missense probably benign
R9021:Mfng UTSW 15 78,657,348 (GRCm39) missense probably benign 0.06
R9289:Mfng UTSW 15 78,643,457 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGCCCAGTGGTCAGAGAC -3'
(R):5'- AGCTCCCTGACTCACAGCTATTAG -3'

Sequencing Primer
(F):5'- CAAGACAGGGCTCTCTGATG -3'
(R):5'- CTATTAGCTGTTGACCTCGGGGAC -3'
Posted On 2016-03-17