Incidental Mutation 'R4872:Smoc2'
ID 376696
Institutional Source Beutler Lab
Gene Symbol Smoc2
Ensembl Gene ENSMUSG00000023886
Gene Name SPARC related modular calcium binding 2
Synonyms 5430426J21Rik, 1700056C05Rik, Smoc2l
MMRRC Submission 042482-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4872 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 14499768-14625052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 14589295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 255 (T255P)
Ref Sequence ENSEMBL: ENSMUSP00000024660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024660]
AlphaFold Q8CD91
Predicted Effect probably benign
Transcript: ENSMUST00000024660
AA Change: T255P

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024660
Gene: ENSMUSG00000023886
AA Change: T255P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 39 84 1.49e-12 SMART
TY 110 157 3.07e-14 SMART
low complexity region 166 177 N/A INTRINSIC
TY 237 285 3.34e-15 SMART
Pfam:SPARC_Ca_bdg 302 412 8.6e-13 PFAM
Meta Mutation Damage Score 0.4325 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPARC family (secreted protein acidic and rich in cysteine/osteonectin/BM-40), which are highly expressed during embryogenesis and wound healing. The gene product is a matricellular protein which promotes matrix assembly and can stimulate endothelial cell proliferation and migration, as well as angiogenic activity. Associated with pulmonary function, this secretory gene product contains a Kazal domain, two thymoglobulin type-1 domains, and two EF-hand calcium-binding domains. The encoded protein may serve as a target for controlling angiogenesis in tumor growth and myocardial ischemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for one KO allele exhibit protection from induced kidney fibrosis and reduced interstitial myofibroblast accumulation. Another KO allele leads to shortening and widening of the skull. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 C A 15: 91,075,514 (GRCm39) V100L probably benign Het
Acad11 G A 9: 103,963,465 (GRCm39) probably benign Het
Actb C T 5: 142,891,307 (GRCm39) probably benign Het
Ano9 G A 7: 140,687,117 (GRCm39) A374V probably damaging Het
Baz2b T C 2: 59,773,103 (GRCm39) probably null Het
Bltp3a G T 17: 28,109,110 (GRCm39) D1110Y probably benign Het
Bpifb9b T A 2: 154,155,551 (GRCm39) L350Q probably damaging Het
Cd27 T A 6: 125,211,281 (GRCm39) probably null Het
Cd72 A G 4: 43,449,563 (GRCm39) probably benign Het
Cdadc1 A T 14: 59,801,973 (GRCm39) S516T probably benign Het
Chst5 T A 8: 112,617,192 (GRCm39) I143F possibly damaging Het
Col20a1 T C 2: 180,639,156 (GRCm39) V452A possibly damaging Het
Cox11 C A 11: 90,535,229 (GRCm39) Q227K probably benign Het
Cpa6 A G 1: 10,665,843 (GRCm39) probably null Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dpm2 T C 2: 32,461,203 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Frem1 A C 4: 82,881,387 (GRCm39) N1273K probably damaging Het
Fry T C 5: 150,317,704 (GRCm39) probably null Het
Gm10306 G T 4: 94,445,069 (GRCm39) probably benign Het
Gm5565 T C 5: 146,094,913 (GRCm39) T278A probably benign Het
Gm8180 A G 14: 44,019,802 (GRCm39) I40T probably benign Het
Iah1 T C 12: 21,367,426 (GRCm39) V44A probably benign Het
Iqgap3 C T 3: 88,020,435 (GRCm39) P360S probably damaging Het
Klhl28 T A 12: 65,003,896 (GRCm39) I206F possibly damaging Het
Krt13 A G 11: 100,012,332 (GRCm39) probably benign Het
Lipo2 T A 19: 33,726,914 (GRCm39) D41V probably benign Het
Lrig2 C G 3: 104,398,842 (GRCm39) V229L possibly damaging Het
Lrrc32 C T 7: 98,147,727 (GRCm39) T169I probably damaging Het
Lrriq1 T C 10: 103,014,649 (GRCm39) N1053S possibly damaging Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Mgat4c G C 10: 102,224,599 (GRCm39) R271P probably damaging Het
Mylk A G 16: 34,735,360 (GRCm39) N780S possibly damaging Het
N4bp1 T C 8: 87,587,676 (GRCm39) T421A probably benign Het
Nat8f1 T C 6: 85,887,295 (GRCm39) T222A probably benign Het
Nsun2 T C 13: 69,691,992 (GRCm39) probably benign Het
Oas2 T A 5: 120,876,599 (GRCm39) D448V probably damaging Het
Or10al7 C A 17: 38,366,467 (GRCm39) V6F probably benign Het
Or2l13b A T 16: 19,349,383 (GRCm39) C96S probably damaging Het
Or5ak22 T C 2: 85,230,772 (GRCm39) Y35C probably damaging Het
Pgm2l1 T A 7: 99,877,204 (GRCm39) L25Q probably damaging Het
Pigp A T 16: 94,166,309 (GRCm39) V133D probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Pomt2 C T 12: 87,156,881 (GRCm39) D752N possibly damaging Het
Ppat T C 5: 77,074,640 (GRCm39) K65E probably damaging Het
Ptprn2 T C 12: 117,125,314 (GRCm39) L616P probably damaging Het
Rad54l2 A G 9: 106,595,091 (GRCm39) S289P probably damaging Het
Rbm39 G A 2: 156,019,266 (GRCm39) R31C possibly damaging Het
Rhbdf2 C A 11: 116,492,771 (GRCm39) V417L probably benign Het
Rnf157 T A 11: 116,246,298 (GRCm39) E255D possibly damaging Het
Rpl6l A T 10: 110,962,304 (GRCm39) noncoding transcript Het
Sec24c A G 14: 20,743,813 (GRCm39) D1006G probably damaging Het
Sh3bp1 G T 15: 78,792,237 (GRCm39) A401S probably benign Het
Slc17a8 A T 10: 89,412,367 (GRCm39) D539E probably benign Het
Slc38a9 T A 13: 112,826,098 (GRCm39) S136R probably damaging Het
Smyd2 T C 1: 189,628,847 (GRCm39) D152G probably damaging Het
Stab1 A G 14: 30,862,350 (GRCm39) V2328A probably damaging Het
Taar2 A G 10: 23,816,591 (GRCm39) I44V probably benign Het
Tbc1d4 T C 14: 101,682,144 (GRCm39) K1251E probably benign Het
Thada G A 17: 84,754,027 (GRCm39) L315F probably damaging Het
Trbv14 T C 6: 41,112,259 (GRCm39) S19P probably benign Het
Ttc39c T C 18: 12,820,173 (GRCm39) probably benign Het
Ttc39d A G 17: 80,524,527 (GRCm39) I395M probably benign Het
Ttn T C 2: 76,548,728 (GRCm39) E31891G probably damaging Het
Ubr3 T C 2: 69,800,527 (GRCm39) V950A probably damaging Het
Usp9y T A Y: 1,307,920 (GRCm39) K2305N probably damaging Het
Vmn1r158 G A 7: 22,490,179 (GRCm39) T10I possibly damaging Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Vmn2r78 T A 7: 86,603,916 (GRCm39) I698K possibly damaging Het
Vmn2r86 G T 10: 130,289,460 (GRCm39) T145K probably damaging Het
Zfp51 T C 17: 21,684,933 (GRCm39) V516A probably benign Het
Zfp654 A T 16: 64,606,145 (GRCm39) S686T probably benign Het
Zfp846 T A 9: 20,502,111 (GRCm39) C55S probably benign Het
Other mutations in Smoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Smoc2 APN 17 14,545,876 (GRCm39) missense probably damaging 1.00
IGL02085:Smoc2 APN 17 14,567,495 (GRCm39) missense possibly damaging 0.79
IGL02309:Smoc2 APN 17 14,595,789 (GRCm39) splice site probably benign
IGL02975:Smoc2 APN 17 14,556,872 (GRCm39) missense probably damaging 0.98
enamel UTSW 17 14,545,896 (GRCm39) missense probably damaging 1.00
FR4976:Smoc2 UTSW 17 14,621,824 (GRCm39) small deletion probably benign
R2291:Smoc2 UTSW 17 14,589,233 (GRCm39) missense possibly damaging 0.53
R2343:Smoc2 UTSW 17 14,564,604 (GRCm39) missense probably benign 0.22
R2888:Smoc2 UTSW 17 14,617,887 (GRCm39) critical splice donor site probably null
R3878:Smoc2 UTSW 17 14,545,879 (GRCm39) missense probably damaging 1.00
R5153:Smoc2 UTSW 17 14,556,841 (GRCm39) missense probably damaging 1.00
R5175:Smoc2 UTSW 17 14,595,719 (GRCm39) missense possibly damaging 0.89
R5239:Smoc2 UTSW 17 14,589,227 (GRCm39) missense probably benign 0.19
R5292:Smoc2 UTSW 17 14,556,835 (GRCm39) missense probably damaging 0.98
R5794:Smoc2 UTSW 17 14,589,310 (GRCm39) missense possibly damaging 0.94
R7810:Smoc2 UTSW 17 14,545,884 (GRCm39) missense probably damaging 1.00
R7996:Smoc2 UTSW 17 14,595,730 (GRCm39) nonsense probably null
R8811:Smoc2 UTSW 17 14,545,896 (GRCm39) missense probably damaging 1.00
R9214:Smoc2 UTSW 17 14,556,839 (GRCm39) missense probably damaging 1.00
R9287:Smoc2 UTSW 17 14,619,686 (GRCm39) missense probably damaging 1.00
X0026:Smoc2 UTSW 17 14,556,895 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGCATCATTTAGCTGTGACTGG -3'
(R):5'- CACACTCAGACTGTGACATTGAG -3'

Sequencing Primer
(F):5'- TGACTGGTCACTGGACTCCAATG -3'
(R):5'- CATTGAGTTTAACAAGAGCTGAGCCC -3'
Posted On 2016-03-17