Incidental Mutation 'R4872:Olfr129'
ID376699
Institutional Source Beutler Lab
Gene Symbol Olfr129
Ensembl Gene ENSMUSG00000081724
Gene Nameolfactory receptor 129
SynonymsGA_x6K02T2PSCP-2503741-2502776, MOR263-9
MMRRC Submission 042482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4872 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38050857-38060079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38055576 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 6 (V6F)
Ref Sequence ENSEMBL: ENSMUSP00000113564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122318] [ENSMUST00000174675] [ENSMUST00000216476]
Predicted Effect probably benign
Transcript: ENSMUST00000122318
AA Change: V6F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113564
Gene: ENSMUSG00000081724
AA Change: V6F

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 4.6e-56 PFAM
Pfam:7TM_GPCR_Srsx 50 319 1.1e-5 PFAM
Pfam:7tm_1 56 305 3.2e-21 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133865
Gene: ENSMUSG00000060017

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216476
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 C A 15: 91,191,311 V100L probably benign Het
Acad11 G A 9: 104,086,266 probably benign Het
Actb C T 5: 142,905,552 probably benign Het
Ano9 G A 7: 141,107,204 A374V probably damaging Het
Baz2b T C 2: 59,942,759 probably null Het
Bpifb9b T A 2: 154,313,631 L350Q probably damaging Het
Cd27 T A 6: 125,234,318 probably null Het
Cd72 A G 4: 43,449,563 probably benign Het
Cdadc1 A T 14: 59,564,524 S516T probably benign Het
Chst5 T A 8: 111,890,560 I143F possibly damaging Het
Col20a1 T C 2: 180,997,363 V452A possibly damaging Het
Cox11 C A 11: 90,644,403 Q227K probably benign Het
Cpa6 A G 1: 10,595,618 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpm2 T C 2: 32,571,191 probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Frem1 A C 4: 82,963,150 N1273K probably damaging Het
Fry T C 5: 150,394,239 probably null Het
Gm10306 G T 4: 94,556,832 probably benign Het
Gm5565 T C 5: 146,158,103 T278A probably benign Het
Gm8180 A G 14: 43,782,345 I40T probably benign Het
Iah1 T C 12: 21,317,425 V44A probably benign Het
Iqgap3 C T 3: 88,113,128 P360S probably damaging Het
Klhl28 T A 12: 64,957,122 I206F possibly damaging Het
Krt13 A G 11: 100,121,506 probably benign Het
Lipo2 T A 19: 33,749,514 D41V probably benign Het
Lrig2 C G 3: 104,491,526 V229L possibly damaging Het
Lrrc32 C T 7: 98,498,520 T169I probably damaging Het
Lrriq1 T C 10: 103,178,788 N1053S possibly damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mgat4c G C 10: 102,388,738 R271P probably damaging Het
Mylk A G 16: 34,914,990 N780S possibly damaging Het
N4bp1 T C 8: 86,861,048 T421A probably benign Het
Nat8f1 T C 6: 85,910,313 T222A probably benign Het
Nsun2 T C 13: 69,543,873 probably benign Het
Oas2 T A 5: 120,738,534 D448V probably damaging Het
Olfr168 A T 16: 19,530,633 C96S probably damaging Het
Olfr992 T C 2: 85,400,428 Y35C probably damaging Het
Pgm2l1 T A 7: 100,227,997 L25Q probably damaging Het
Pigp A T 16: 94,365,450 V133D probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pomt2 C T 12: 87,110,107 D752N possibly damaging Het
Ppat T C 5: 76,926,793 K65E probably damaging Het
Ptprn2 T C 12: 117,161,694 L616P probably damaging Het
Rad54l2 A G 9: 106,717,892 S289P probably damaging Het
Rbm39 G A 2: 156,177,346 R31C possibly damaging Het
Rhbdf2 C A 11: 116,601,945 V417L probably benign Het
Rnf157 T A 11: 116,355,472 E255D possibly damaging Het
Rpl6l A T 10: 111,126,443 noncoding transcript Het
Sec24c A G 14: 20,693,745 D1006G probably damaging Het
Sh3bp1 G T 15: 78,908,037 A401S probably benign Het
Slc17a8 A T 10: 89,576,505 D539E probably benign Het
Slc38a9 T A 13: 112,689,564 S136R probably damaging Het
Smoc2 A C 17: 14,369,033 T255P probably benign Het
Smyd2 T C 1: 189,896,650 D152G probably damaging Het
Stab1 A G 14: 31,140,393 V2328A probably damaging Het
Taar2 A G 10: 23,940,693 I44V probably benign Het
Tbc1d4 T C 14: 101,444,708 K1251E probably benign Het
Thada G A 17: 84,446,599 L315F probably damaging Het
Trbv14 T C 6: 41,135,325 S19P probably benign Het
Ttc39c T C 18: 12,687,116 probably benign Het
Ttc39d A G 17: 80,217,098 I395M probably benign Het
Ttn T C 2: 76,718,384 E31891G probably damaging Het
Ubr3 T C 2: 69,970,183 V950A probably damaging Het
Uhrf1bp1 G T 17: 27,890,136 D1110Y probably benign Het
Usp9y T A Y: 1,307,920 K2305N probably damaging Het
Vmn1r158 G A 7: 22,790,754 T10I possibly damaging Het
Vmn2r78 T A 7: 86,954,708 I698K possibly damaging Het
Vmn2r86 G T 10: 130,453,591 T145K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp51 T C 17: 21,464,671 V516A probably benign Het
Zfp654 A T 16: 64,785,782 S686T probably benign Het
Zfp846 T A 9: 20,590,815 C55S probably benign Het
Other mutations in Olfr129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr129 APN 17 38055590 start codon destroyed probably null 0.15
IGL02163:Olfr129 APN 17 38054750 missense probably benign 0.06
IGL02374:Olfr129 APN 17 38055521 missense probably damaging 1.00
R0840:Olfr129 UTSW 17 38055572 missense probably benign 0.00
R1774:Olfr129 UTSW 17 38055437 missense probably benign 0.00
R3720:Olfr129 UTSW 17 38055368 missense probably damaging 1.00
R3794:Olfr129 UTSW 17 38054895 missense probably damaging 1.00
R3840:Olfr129 UTSW 17 38055348 missense probably damaging 1.00
R4002:Olfr129 UTSW 17 38054988 missense probably damaging 1.00
R4273:Olfr129 UTSW 17 38055272 missense probably damaging 1.00
R5606:Olfr129 UTSW 17 38054802 missense probably damaging 0.98
R6309:Olfr129 UTSW 17 38055152 missense probably damaging 1.00
R7269:Olfr129 UTSW 17 38055551 missense probably damaging 1.00
R7450:Olfr129 UTSW 17 38055109 missense probably benign 0.00
R7829:Olfr129 UTSW 17 38055329 missense possibly damaging 0.64
R8103:Olfr129 UTSW 17 38055012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGGTTATGAGTGCATTTCCTG -3'
(R):5'- CCAGGACTGCAAGTTTCCAC -3'

Sequencing Primer
(F):5'- AGTGCATTTCCTGTCAGTGATAC -3'
(R):5'- GGTCAGTACACTTTGGAAAATCCC -3'
Posted On2016-03-17