Incidental Mutation 'R4872:Ttc39d'
ID376700
Institutional Source Beutler Lab
Gene Symbol Ttc39d
Ensembl Gene ENSMUSG00000046196
Gene Nametetratricopeptide repeat domain 39D
Synonyms4930560E09Rik
MMRRC Submission 042482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4872 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80207460-80217936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80217098 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 395 (I395M)
Ref Sequence ENSEMBL: ENSMUSP00000123158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053168] [ENSMUST00000134652]
Predicted Effect probably benign
Transcript: ENSMUST00000053168
AA Change: I395M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053781
Gene: ENSMUSG00000046196
AA Change: I395M

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 9.6e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134652
AA Change: I395M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123158
Gene: ENSMUSG00000046196
AA Change: I395M

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 7.2e-150 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 C A 15: 91,191,311 V100L probably benign Het
Acad11 G A 9: 104,086,266 probably benign Het
Actb C T 5: 142,905,552 probably benign Het
Ano9 G A 7: 141,107,204 A374V probably damaging Het
Baz2b T C 2: 59,942,759 probably null Het
Bpifb9b T A 2: 154,313,631 L350Q probably damaging Het
Cd27 T A 6: 125,234,318 probably null Het
Cd72 A G 4: 43,449,563 probably benign Het
Cdadc1 A T 14: 59,564,524 S516T probably benign Het
Chst5 T A 8: 111,890,560 I143F possibly damaging Het
Col20a1 T C 2: 180,997,363 V452A possibly damaging Het
Cox11 C A 11: 90,644,403 Q227K probably benign Het
Cpa6 A G 1: 10,595,618 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpm2 T C 2: 32,571,191 probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Frem1 A C 4: 82,963,150 N1273K probably damaging Het
Fry T C 5: 150,394,239 probably null Het
Gm10306 G T 4: 94,556,832 probably benign Het
Gm5565 T C 5: 146,158,103 T278A probably benign Het
Gm8180 A G 14: 43,782,345 I40T probably benign Het
Iah1 T C 12: 21,317,425 V44A probably benign Het
Iqgap3 C T 3: 88,113,128 P360S probably damaging Het
Klhl28 T A 12: 64,957,122 I206F possibly damaging Het
Krt13 A G 11: 100,121,506 probably benign Het
Lipo2 T A 19: 33,749,514 D41V probably benign Het
Lrig2 C G 3: 104,491,526 V229L possibly damaging Het
Lrrc32 C T 7: 98,498,520 T169I probably damaging Het
Lrriq1 T C 10: 103,178,788 N1053S possibly damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mgat4c G C 10: 102,388,738 R271P probably damaging Het
Mylk A G 16: 34,914,990 N780S possibly damaging Het
N4bp1 T C 8: 86,861,048 T421A probably benign Het
Nat8f1 T C 6: 85,910,313 T222A probably benign Het
Nsun2 T C 13: 69,543,873 probably benign Het
Oas2 T A 5: 120,738,534 D448V probably damaging Het
Olfr129 C A 17: 38,055,576 V6F probably benign Het
Olfr168 A T 16: 19,530,633 C96S probably damaging Het
Olfr992 T C 2: 85,400,428 Y35C probably damaging Het
Pgm2l1 T A 7: 100,227,997 L25Q probably damaging Het
Pigp A T 16: 94,365,450 V133D probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pomt2 C T 12: 87,110,107 D752N possibly damaging Het
Ppat T C 5: 76,926,793 K65E probably damaging Het
Ptprn2 T C 12: 117,161,694 L616P probably damaging Het
Rad54l2 A G 9: 106,717,892 S289P probably damaging Het
Rbm39 G A 2: 156,177,346 R31C possibly damaging Het
Rhbdf2 C A 11: 116,601,945 V417L probably benign Het
Rnf157 T A 11: 116,355,472 E255D possibly damaging Het
Rpl6l A T 10: 111,126,443 noncoding transcript Het
Sec24c A G 14: 20,693,745 D1006G probably damaging Het
Sh3bp1 G T 15: 78,908,037 A401S probably benign Het
Slc17a8 A T 10: 89,576,505 D539E probably benign Het
Slc38a9 T A 13: 112,689,564 S136R probably damaging Het
Smoc2 A C 17: 14,369,033 T255P probably benign Het
Smyd2 T C 1: 189,896,650 D152G probably damaging Het
Stab1 A G 14: 31,140,393 V2328A probably damaging Het
Taar2 A G 10: 23,940,693 I44V probably benign Het
Tbc1d4 T C 14: 101,444,708 K1251E probably benign Het
Thada G A 17: 84,446,599 L315F probably damaging Het
Trbv14 T C 6: 41,135,325 S19P probably benign Het
Ttc39c T C 18: 12,687,116 probably benign Het
Ttn T C 2: 76,718,384 E31891G probably damaging Het
Ubr3 T C 2: 69,970,183 V950A probably damaging Het
Uhrf1bp1 G T 17: 27,890,136 D1110Y probably benign Het
Usp9y T A Y: 1,307,920 K2305N probably damaging Het
Vmn1r158 G A 7: 22,790,754 T10I possibly damaging Het
Vmn2r78 T A 7: 86,954,708 I698K possibly damaging Het
Vmn2r86 G T 10: 130,453,591 T145K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp51 T C 17: 21,464,671 V516A probably benign Het
Zfp654 A T 16: 64,785,782 S686T probably benign Het
Zfp846 T A 9: 20,590,815 C55S probably benign Het
Other mutations in Ttc39d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Ttc39d APN 17 80216526 missense probably damaging 0.99
IGL01065:Ttc39d APN 17 80216274 missense probably damaging 0.96
IGL01834:Ttc39d APN 17 80216046 missense probably benign
IGL02541:Ttc39d APN 17 80216446 missense probably damaging 0.99
PIT4687001:Ttc39d UTSW 17 80216925 missense probably damaging 1.00
R0042:Ttc39d UTSW 17 80215950 missense probably benign 0.02
R0042:Ttc39d UTSW 17 80215950 missense probably benign 0.02
R0124:Ttc39d UTSW 17 80216946 missense probably damaging 1.00
R0523:Ttc39d UTSW 17 80216457 missense possibly damaging 0.78
R0801:Ttc39d UTSW 17 80216215 missense probably damaging 1.00
R1581:Ttc39d UTSW 17 80216484 missense probably benign 0.02
R2071:Ttc39d UTSW 17 80216601 missense probably damaging 1.00
R2271:Ttc39d UTSW 17 80217246 missense probably damaging 1.00
R2272:Ttc39d UTSW 17 80217246 missense probably damaging 1.00
R2520:Ttc39d UTSW 17 80216370 missense probably benign 0.17
R2885:Ttc39d UTSW 17 80216715 missense probably benign 0.00
R2939:Ttc39d UTSW 17 80217553 missense probably damaging 1.00
R2940:Ttc39d UTSW 17 80217553 missense probably damaging 1.00
R3081:Ttc39d UTSW 17 80217553 missense probably damaging 1.00
R4669:Ttc39d UTSW 17 80217639 missense probably benign 0.00
R4951:Ttc39d UTSW 17 80216033 missense probably benign 0.01
R6260:Ttc39d UTSW 17 80216647 nonsense probably null
R7018:Ttc39d UTSW 17 80216181 missense probably benign 0.06
R7042:Ttc39d UTSW 17 80216462 missense probably benign 0.00
R7468:Ttc39d UTSW 17 80216150 missense possibly damaging 0.96
R7761:Ttc39d UTSW 17 80217312 missense probably damaging 0.98
R7825:Ttc39d UTSW 17 80216146 missense probably damaging 0.99
R7955:Ttc39d UTSW 17 80215923 missense probably benign
R8192:Ttc39d UTSW 17 80216578 missense probably damaging 0.99
R8400:Ttc39d UTSW 17 80216005 missense probably benign 0.15
R8682:Ttc39d UTSW 17 80217264 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCCGTGCACGTTTTAACATG -3'
(R):5'- AAACCAGCCTGTCGTAGTAC -3'

Sequencing Primer
(F):5'- GCTAAACGGTAATTTTGAAAGCGC -3'
(R):5'- TGTCGTAGTACCATAGCGCTGAC -3'
Posted On2016-03-17