Incidental Mutation 'R4874:Olfr1094'
ID376761
Institutional Source Beutler Lab
Gene Symbol Olfr1094
Ensembl Gene ENSMUSG00000044213
Gene Nameolfactory receptor 1094
SynonymsGA_x6K02T2Q125-48321457-48322449, MOR179-7
MMRRC Submission 042484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4874 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86824663-86830282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86829254 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 167 (H167Q)
Ref Sequence ENSEMBL: ENSMUSP00000148902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105211] [ENSMUST00000217509]
Predicted Effect probably damaging
Transcript: ENSMUST00000105211
AA Change: H167Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100846
Gene: ENSMUSG00000044213
AA Change: H167Q

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 4.6e-52 PFAM
Pfam:7tm_1 53 316 3.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217509
AA Change: H167Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.1786 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,536,183 noncoding transcript Het
Aadat G A 8: 60,516,113 probably null Het
Adamtsl1 A G 4: 86,342,492 N988S possibly damaging Het
Aph1b A T 9: 66,790,596 probably null Het
B4galnt3 C A 6: 120,207,206 R880L probably damaging Het
Bcam T C 7: 19,769,322 probably benign Het
Cr2 A T 1: 195,176,570 I14N possibly damaging Het
Dcdc5 T C 2: 106,368,106 noncoding transcript Het
Dll1 A T 17: 15,370,239 M405K probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ern2 T C 7: 122,176,587 D428G probably benign Het
Esp36 A T 17: 38,417,096 M98K unknown Het
Foxd2 G T 4: 114,907,571 H417Q possibly damaging Het
Glrb T C 3: 80,851,042 N304D possibly damaging Het
Haus3 A G 5: 34,167,628 V229A probably benign Het
Hpgd A T 8: 56,317,803 I159F possibly damaging Het
Ighv1-22 T A 12: 114,746,416 I70F probably benign Het
Il16 A T 7: 83,660,945 F584L possibly damaging Het
Lamc2 T C 1: 153,154,395 D167G probably null Het
Megf10 G A 18: 57,293,858 V1083I probably benign Het
Mertk T C 2: 128,750,159 S268P probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mki67 T C 7: 135,708,771 D132G probably damaging Het
Nbas A G 12: 13,321,755 N419D probably damaging Het
Negr1 T C 3: 156,859,445 L56S probably damaging Het
Nup214 A G 2: 31,980,584 probably null Het
Olfr16 A G 1: 172,957,599 E268G probably benign Het
Olfr707 C T 7: 106,891,435 V225I probably benign Het
Opn5 C G 17: 42,580,719 A276P probably damaging Het
Papln G T 12: 83,777,143 V499L probably benign Het
Pgap1 A T 1: 54,530,137 W357R probably damaging Het
Pibf1 T C 14: 99,140,556 Y373H probably damaging Het
Pitpnm1 T C 19: 4,112,252 probably null Het
Prcd T A 11: 116,659,771 W3R probably null Het
Prkaa1 A G 15: 5,174,357 N249S probably benign Het
Reg3b T A 6: 78,372,826 N116K possibly damaging Het
Rpusd2 T C 2: 119,034,879 L19P probably benign Het
Rufy1 T C 11: 50,406,450 T392A possibly damaging Het
Sall3 T C 18: 80,973,973 K247E probably benign Het
Shank1 C T 7: 44,316,073 T191M unknown Het
Slit1 C T 19: 41,729,054 probably null Het
Sorl1 A T 9: 42,063,752 V520E probably damaging Het
Vmn2r115 T A 17: 23,359,851 F766Y probably damaging Het
Zfp644 A G 5: 106,635,413 S1032P probably damaging Het
Other mutations in Olfr1094
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Olfr1094 APN 2 86829368 missense probably benign
IGL03053:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL03168:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL02799:Olfr1094 UTSW 2 86828956 missense probably damaging 0.99
R0511:Olfr1094 UTSW 2 86829606 missense probably benign 0.02
R0944:Olfr1094 UTSW 2 86828937 missense probably benign 0.01
R1065:Olfr1094 UTSW 2 86829544 missense probably damaging 0.98
R1476:Olfr1094 UTSW 2 86829198 missense probably benign 0.31
R1807:Olfr1094 UTSW 2 86829101 missense probably benign 0.03
R2865:Olfr1094 UTSW 2 86828854 missense probably benign 0.21
R2915:Olfr1094 UTSW 2 86829226 missense probably benign 0.02
R3055:Olfr1094 UTSW 2 86829127 missense possibly damaging 0.94
R3104:Olfr1094 UTSW 2 86829691 missense probably benign 0.03
R4862:Olfr1094 UTSW 2 86829532 missense probably damaging 1.00
R5505:Olfr1094 UTSW 2 86829501 missense possibly damaging 0.88
R5507:Olfr1094 UTSW 2 86829317 missense probably damaging 1.00
R6318:Olfr1094 UTSW 2 86829654 missense possibly damaging 0.73
R6538:Olfr1094 UTSW 2 86829525 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGTCACTCCGAAGATGTTGG -3'
(R):5'- AGGATGGTGATGATCTCAATGG -3'

Sequencing Primer
(F):5'- CATACCCTGGTTGTGTAACAGAG -3'
(R):5'- GTGATGATCTCAATGGAGCCTACAC -3'
Posted On2016-03-17